Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5282  (registered. 2003)
Contig Information
Length 1050 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 791
Evalue 4.30207e-134
Total Hit Count 335
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5282
CCCGATCCGTCCAAGTCGCCGACGGGGGGATCTTCGTCGCTCATCTTCCTGGGCACGGGCTGCTCCGGCGCGCTGCCCGACGCACGGTGCCTCCTCAAGC
CGTCAACGCCGCCCTGCGCCGTCTGCTCCATGGGCATCTCCCTCCCTCCGGAGGGGAACCCCAACTACAGGCTCAACACCTCCCTTCTTGGTAGACTATT
GCCCATGGAGATGGAACCCACAAGTACATCCTAATCGACATCGGCAAGACCTTCAGAGAGCAAGTTCTCCGGTGGTTTGTCCACCACAAAGTTCCTTACG
TTGACTCGATCATTCTGACTCATGAGCATGCAGATGCTGTATTAGGCCTTGACGAAGTCTGGGTGGTACAACCAAGAAATGACCGAAACGATGTCGAGAA
AATTCCTATCTTCCTCACACAATTCACGATGGACAGTATCGCGAGAAGATTCCCCTACTTGGTGGAGCAGAAGCCAGAGGATGGCGATGAAGATGCCCAA
GCCGCAAAAATCGAGTGGAAGATAGTTCAGGATGATGTTGAGAAACCGTTTGTAGCATCAGCACTAGAATTTGTGCCATTGCCGGTAATGCATGGAGAAG
GGTATATTTGTTTAGGCTTCTTATTTGGGAGGAGAGCCAGAGTTGCGTATTTATCTGATGTCTCAAGATTTCTACCTAAAACCGAGCATGAGTCTTGATG
CTATCAAGAGGATCCATCCTAAAAGAGCTCTGTTGATTGGAATGAGGCATTTTTTTGAGCATCAGAGAGAAAACCAGATGTTGGCAGAATGGTCTATCAG
AGAAGGAATACCGACACAACTTGCTCATGACGGCCTGCGAGTCTCCATTGACTTGTAATAAGGTATGCAAGGTTGCTATGCAATACTTGAGGACGACTAC
TTGGCACCTTTGAACAATTTAAATCATGTCAGTGCAGATTGCAGCATTCATATATCTTTTTCTGATTCAGCAAAGATCCACAATAGCAGTAGTTGTAGCA
GTTATTTTGTGATCTTTTATGTATCCAAAAGATTGTAAGTTTGCTCATGT
page-top