Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5245  (registered. 2003)
Contig Information
Length 724 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Homology (BLAST) Top Hit gibberellin MYB transcription factor [Brachypodium sylvaticum]
Score 834
Evalue 1.61212e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5245
CACAGGCCGTCAGTTTGTTCAGCGCAACCACACCTTTGTAGCTGAGCTTTGGTTTAGTCAGAGCGCAGGGCAAGACCTACAGATATGTACATCCTTTCTA
CAACTTGCGATCTTGCTCTTATAGACCTCAGCCACTAGCTATTCACAACGCTGAATCAAGGTACCCGTAGAACCGTCGACGACTGTACTGGAGGAGGCTG
CTATAGTTGCGATCATGTACGCTGACAAAGAGAGCCTCGGTGTCAGGACTGAACGATATGCCGGCAATCTCACCAAAGAAGTCCAGCTCCTGCTTCCTGT
CGTACCCGCTCCTGACGTCGAAGATGTGGATGAAGTCTGCAGCTTCGGCCATTGCCAGGAACTTGCCGTCAGATGTATAGTGGATCGACCTTATGGCTCC
CATGTTGCCTCCCAGGACAGCGACAGACTTGGAGAGGTTACGGGCGTCCCAGATCCTGCATGTCTTGTCTTGGTTCCCAGTCGCGAATGTTCGGCCGTCT
GGGTTCCATGCCGATGCAAACGAATAGTCCAAATGACCATTGAGCTCATGAATCATTTTCCCCGAATTAGCATCAACCAGAACACCATCAGGATTGTCCC
CCACAATAGCAATGATTTTACCATCAGGGCTCAAGGGATGTGTGATTCACAGCCCCAATCAAAATGAAAAATGATTGCACATTTGAAACTTCTCCATGTC
AAAGTCTCTTAGTCCNCAATCATT
page-top