Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5011  (registered. 2003)
Contig Information
Length 579 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Homology (BLAST) Top Hit Os09g0373000 [Oryza sativa (japonica cultivar-group)] >gi|49387802|dbj|BAD26367.1| brain protein 44-like [Oryza sativa Japonica Group] >gi|113631262|dbj|BAF24943.1| Os09g0373000 [Oryza sativa (japonica cultivar-group)] >gi|215765123|dbj|BAG86820.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218202048|gb|EEC84475.1| hypothetical protein OsI_31133 [Oryza sativa Indica Group]
Score 511
Evalue 2.76044e-50
Total Hit Count 363
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5011
CGCTCGTTCCTCAGCCGTTGGCCGTCTCCACGAGTCCATCCGCACCCGCGGACGGCAGGCAAACAACCGTATAGGGGGCGAGGTTCTCCGCCATGGCGAC
GGCGTTCAAGGCGTTCTTGAACAGCCCCGTCGGCCCCAAGACCACGCACTTCTGGGGACCCGTCAGCAACTGGGGCTTCATCCTCGCGGGTATGGCTGAC
ATGAACAAGCCACCTGAATTGATATCCGGTCATATGACTGCAGTCATGTGTGTGTATTCTGGCCTATTTATGAGGTTCGCATGGGTCGTACGGCCCCGAA
ACTATTTTCTTATGGCAACCCATGCCTCCAACGAAAGCGTTCAGCTCTACCAGTTATCTCGCTATGCTAGGGCTCAAGGTTACCTAGAGAAGAAAGAGCC
TGAGGCCCAACAGTAACTATGGCCCAACGAACACTGTAGACACTATTTATGTAAGCAGAATTGGTTTCGGGCAATTTGTAATGCATGTAATCGTACGTTT
ATGCATTAGTTACACTGTCGGAATACACCAAAATGGAAACCCATATGATACAGAACGAGATCCTTTGACAAAAAAAAAA
page-top