Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig5006  (registered. 2003)
Contig Information
Length 665 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os01g0680700 [Oryza sativa (japonica cultivar-group)] >gi|56202291|dbj|BAD73750.1| unknown protein [Oryza sativa Japonica Group] >gi|113533406|dbj|BAF05789.1| Os01g0680700 [Oryza sativa (japonica cultivar-group)] >gi|215704813|dbj|BAG94841.1| unnamed protein product [Oryza sativa Japonica Group]
Score 388
Evalue 6.97802e-36
Total Hit Count 79
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig5006
CGCCGCGTCCATCATCACCAGCAGCACCACGCCACCCCGATCGATCCCATGATTGACGCCATGTTTTCTTGCGCGATCAGGTCCGTTGAGGAGCGATCGG
GCGGCGTGCACAAGCGGTCGTCGCCCGACAAGGCGCCGCACCACAAGCCCCCCGCCGCGGAGCATCACATGGATTCCAAGAACGCCCACCACCACCACAA
CAACAACCACGACTCGCAGCTGGCGTCCGCCGCCAACGGCAACGGCACGGGCGCCGGCGAGAAGCTGGGCGGGGAGCGGCTGGAGCTTCCCCGGATCTAC
ATCTCGCTGTCCCGCAAGGAGAAGGAGGACGACTTCCTGGTGATGAAGGGCACCAAGCTGCCCCAGAGGCCCAAGAAGCGGGCCAAGAACGTGGACAAGT
CGCTCCAATTCGTGTTTCCAGGGATGTGGCTCTCGGATTTGACCAAGGGCCGGTATGAGGTGCGAGAGAAGAAATGTGTCAAGAAGAGGCGAAGAGGGCT
GAAAGGGATGGAGAGCATGGACAGCGACTCGGAGTGAAGAGCGCAGAGGAAAGGAGACGAGACGGCCAAGGAAGAAGATGGGGATGTCATGTGTGGAGCG
AGGCGTGTTAGGAGAAAACAAAACCGGTAGAGAGAGCTTAGCCCAAAGGAATGGACCGCGACATT
page-top