Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4996  (registered. 2003)
Contig Information
Length 500 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit hypothetical protein OsI_01154 [Oryza sativa Indica Group]
Score 216
Evalue 2.91391e-16
Total Hit Count 43
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4996
TGGCCTGCAGATGTCCTCCGATTCGGTGGACGCCGGGCAGTTCGCGCAGCCTAGGCCGCCGATGGGCCTGCCAGGCCAGCTGTCCGACACCGTCAGCGCA
GCGGCGGCCGCGATCACCGCGGACCCAAACTTCACAGTGGCGCTCGCCGCGGCCATCTCGTCGATCATGGCCGGCCAGCACGCCGCCGGCAACAGCAACG
CGAACAACAGCAACAACAACACCAGTAACAACAACGTGACGACGACTAGTAACAACACGACGAGCAACAACACCAACAGCGAGACCCAATGAACGACCTG
GTCAAGTTCGAAAAGAGTTGAGAAACCAGATACTAGCTAGGTTGCAAGTTATACACGGATGGTGTTCCATTCTTCTTTGGTCAGGATTAGCTTGTCGAGA
CGTGTCTTTGGTTTTGATACCAAGCATGATATACGATCACCCTTTTTCTTTCGTGATTTTGCGGCGGCAAAAAAAAGGTTGTATTAGTTCAAAAAAAAAA
page-top