Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4981  (registered. 2003)
Contig Information
Length 898 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit serine/threonine protein kinase [Hordeum vulgare subsp. vulgare]
Score 580
Evalue 6.76578e-58
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4981
TAAGTACATCCCCTCCTGGTGTTCTCTTCCCGGCTTGGATCCCTGTGATCAAGTGTTCCTCTCAAAGCAATGAGCACCGGCGGTATAACCCTAGAAAACC
TACCGAAGGAACTACCCACTAGACTTTTTCAAGGAAATTACAAATAACTTTGCCAGTGAAATAGGTTCAGGTGCATTTGGGTCTGTTTATAAGGGGATTC
TGGGTGGTGGTGGAGTGGTGGCTGTGAAGAAACTCGCCGAAAATTCACCTGTGCCACGCGATGAAATCTTTAAGAAAGAGGTTCAGAATATCATGGTGCT
CGAACATGAAAATATTGTGAAGTTTCTTGCATACTGCCGTGAAGGACAAAACAGATTGGTCCAGAGCAATGGAAGACACATTATTGCAGAGATTACTGAA
ACTTTACTCTGCTATGAATACGTACCTAATGGGAGCCTTGAGCAGAATCTTTTTGGTGAATCCAGTAACATTGATTGGGACACACGTTTCAAAATAATAA
AGGGGATCTGTGAGGGTATACGTTTTCTGCATGGATTGCCTTGTCCGGTTCTCCATTTGGGTCTGAAGCCTCAAAATATATTCCTGGATGGAAACATGGC
CCCCAAAATTGCGGAATTTGGATTCTCCAGAATATTTGGGGAAGACCAAACACGAATGAACACGCGAAGTGTTGTGGGATCTGTCTCTCCCATCACAAGT
GAGCACAAGACTTCGCATTTTTCAATGAGATAAACCCAAGATAAAGTAAAACAAGATCCGACAAGGCTACAATAACACAAGTGAATGTGGGAACATGACC
CACTAATGTAACACCATTGCAGGAATATTTAAATTTTAATTCCATTGGATTTTTATTTGATAAATAGGTATCAAGAGAGAATAGAGTTACGCCCATTT
page-top