Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4974  (registered. 2003)
Contig Information
Length 351 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Homology (BLAST) Top Hit enolase [Davidiella tassiana]
Score 360
Evalue 5.44664e-33
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4974
CTTCGCCGCTGGCTGGGGTGTCATGGTCTCCCACCGTTCCGGTGAGACCGAGGACGTCACCATCGCCGACATCGTCGTCGGTCTCCGTGCCGGCCAGATC
AAGACCGGTGCTCCTGCCCGTTCCGAGCGTCTTGCCAAGCTCAACCAGATCCTCCGTATCGAAGAGGAGCTTGGTGACAAGGCTATCTACGCTGGTGACA
AGTTCCGCACTGCCATCAACATGTAAGCTGCTTTTAGCTTGATGGCTATACAGTAGTAATTTCTTTATCATGAGATGAACGTGACGGATGCATGGCTAGC
GTTAGTCGGATGAACAAAAAAAGTATTCAAATGTCCAAACGAAAAAAAAAA
page-top