Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5840  (registered. 2012)
Contig Information
Length 879 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_KMP Shoot grown under continuous light 4
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_VWD Shoot grown with dessication 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|21667479|gb|AAM74066.1|AF490471_1|AF490471_1 CONSTANS-like protein [Hordeum vulgare subsp. vulgare]
Score 416
Evalue 2.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5840
TTTTTTTTTTGTTATATGACGTCAGTTCATTAGNTTTTTTTGTAGAAGAAGAAAGATCTATCCGGCATCTTTCATATATTTACAGGTGAAGCTTTGACGC
CTCCAATAAATTTCTGAATATTCGGCAAATTAAGGAGAGCGAGCCAACATGTAGGCGTCGATCGACTATGGAAGGAGGAACGCTCATGGTCTCTCCACCG
AGCCGGCCTAGAAAGTCGGCACAACGCCGCAGCTGGAGTCGGACAGCGCGGCTGCGGAGAAGTACTGGTCCACCTCGAGGTCGGCGTCGGCGCGCTTGGC
GAATCGCCCCTTGATCCGTGGCCTGGTCTCGGCGTAGGCCTTCCGCGACGCGTACCTGATGGTCTTCTCGAACCGCCTCATCTTCCTCTTCTCCCTGTAC
CGGTGCACCCTGGCCTCCCTGTCCATCGCCATGCCCATGAACTGCGGCGACATGTGCGCCGCCGCTGAGAAGAGGTCGACGCTGCTCTCGCTGCGCCTCA
TGTACGAGCTGGTCACATCCTGGACGGTGCTACTGTTGTCCGGTGATGATGACATTGAAAGGCTGCGTTGGAATGTTGCGCCAAATCCGTACCCATGGTT
AGAATTTTGTGCATCGTACGGCATCTCCGCCGTGAAGCCCTGCCGCTCATGCAGCTGCGCCACCGGCTCGCCGGGCACAACGAGCTCGTGGCTGCCCTCG
TTGCTCTCCATCCCGTGGCCGCGGTACTCCTTGCTCGACGCGTCCTTCTCGCCTGCTCGTCCGAGGTCAAGGAAGTCAGCGACGAGCGCGTCGCCGAACG
CCGGCGCATCCCCCTCCGGGCCCCGGAGCGGGTCCAGCAGCAGCCACGACGTCGCTTCCTCCTCCTCCTCCTCTCCCTC
page-top