Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4970  (registered. 2003)
Contig Information
Length 1113 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Homology (BLAST) Top Hit PREDICTED: notochord specific gene 9 protein [Ciona intestinalis]
Score 117
Evalue 0.000465231
Total Hit Count 408
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4970
TATGATCACAAAGCCGCCAAAAAAGGCTAGGGCTGCCGCGAAAGCCGCGAGAAAGACCAACAAGAAACCTAAGAAGAAATCAAGCGCCTCTGATCTGCTT
AAGATGGATGACACCTCTGAGTCGGAGGTAGCCCTTGACTCTCTTGGCTTATTTTTCAACCATCTTATTGACACTGACTATTACCAGGATGACACGGGAG
TCAGCCAAGCAGTTGAAGAAGAGGACAGCAACACGAGAACACCAGACCCGGACCGGTGCAGGAAATTTCTCGATCTTCCTCTGGCGATTCATCTCAGACC
CAGCTGTCGCCTTTCAAGACTGTCCTTGGTGGTCAAGCAAAGCCCAATAAGAAGGTGAAGGTGACAAAACCGGCCGAAGACGCTAAAGTTGCTGAACCGG
ACCAGCAAGCTTCTGCACCAGAAGCCTGTGAACAACAACGAGAAGATCCTGCTTCCAATACTCAAACTGAAATGCCTGAGTTGTCTGTTGATCAAACCAA
CATTAACCCTTCAACTACTGAACCGTCCAGCTTACTTAACCTGCCAGAGACTTATGCTGATGACATTCTGATCACTGGCACTGGTTTTACTGAACCGGGA
AACCCAACTATGTTAGCCAGACATTCTGCCAAGCAAGAAGTCATGGAGAGACGGAAAGTGAAATTTGATGTCTCCCACTATGCTCAATTGAGCAGTAGTG
AAGTATTGTCTGGTTATCTCAATCAAGTACACTCCATCCATGATTTGGAAATTGAAATGGTGAAACAGATGCACCAGAAGTATGAGGCTGCGACTGCTGA
ATTGGAATCTCAACTGAACGACGCCAAGACTCGGCTGGTGGCTCAAGAAAATGAAACCCGGAAGGCTGAGTCGAAATTCTAGTTTAGTGTGACTGAATCA
GAAAAGTTGAAGACCAGCTTTAAGGCGGAGAAAAAGACTTGGGTTGAAGAAAGGAATGTTTTAACGCAGCGGGCCAAGAAAGCAGAAGCAACTCTTCAGG
AGGTGACCACTGAGCCCTCCGTCTTAAAACACCGTGTGTCTCAGATGGTTTCTGCTATCTTCGGTGAGTCGCCTTGTTATTCATCCAAAGTGGGTACTTG
TCACCATAATGTA
page-top