Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4967  (registered. 2003)
Contig Information
Length 316 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Homology (BLAST) Top Hit hypothetical protein BDU_7020 [Borrelia duttonii Ly] >gi|201084501|gb|ACH94083.1| uncharacterized conserved protein [Borrelia duttonii Ly]
Score 76
Evalue 4.68555
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4967
GCACACGGAGCGCAGGTACTATATTTGAGGGTCGCTGTTGGATAGCTGTGGTCCATACAATCATCACCAATCCAGTCCTGTAATCAATCCCTGAATATTC
TTGTGAGTTGCTGAAGCGTAGATAGCCTTTTGTCAGCTCTGTTTCTTTCTTCTCTGGGCTTGCGATGATCCATTTACTTGTAAGATGCTAGTCCTGTTTA
TCTTATGGAGACCTTTATCTTGTAAAGCTTTGTCTGAAGACTATTCTACTTCTGATGGCCGAATACTGCACGGATCGCTGTTTGGGTGTCACGAGAAGCT
TTTCTGAAAAAAAAAA
page-top