Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4965  (registered. 2003)
Contig Information
Length 804 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Homology (BLAST) Top Hit hypothetical protein SNOG_09915 [Phaeosphaeria nodorum SN15] >gi|111061130|gb|EAT82250.1| hypothetical protein SNOG_09915 [Phaeosphaeria nodorum SN15]
Score 801
Evalue 9.07453e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4965
TCGACGCTGAATGCGCACCTCTTCACCGTCTTTGCAGATTGCAGCTGGAGCCGCCATTTTGTATCCTGTCGGCAATTCGACGTTGATCCACGCCGCCGTG
GACAGCGTGCTTTTGTTCATCTACCCCCTTGCTGAAGCGCTGTACAAACTATCCTCAAGTCGAGCTTGGATTCGGGGCTGTCGTACGCGATATTTATAGT
AACGTCAATGCTCGGAAAGGATCCACTGGCGCCGCTGTTTGATCCATCGTTGGAATACTCAGACCGCGTGGCCAAAGTAGCTGAATCGCCTCTGGCCCAG
TCGGCCGTGTGTCTTTACGTCGCGGGCATCCTCTGGTGTGTCACATTCGACACGCTATATGCCCATCAAGACTACCTCGATGATCTTAAAGCTGGTGTCA
TGGGACTCGCCGTAAGACTGGGAAGGAAGGGGACGAAGCCGACCCTCTACTTGGTATCCGTAGTACAGGTGGCCTGTCTTGCATGGGCAGGCCGTCTGGC
AGGGTTTGGTGACGCGTATTATGCTGTCTCATGTGGTGGAACGGGGCTGATGTTGATATGGACAATCTGGGTTACTAACCTGGAAGATGGCGCCAGTTGC
GCCTGGGCATTTGGTCCCGGAAGTGCTTATGCTGGCGCCTTGGTTTCTGGAGGGCTTTTGATTGAGTTCTTGTCCAAAAAGTACGGATACTGATCTATCA
TGCGAAAATTCAATATGTGGTATGAAAGCTCGCTAGGGGAAGTTGCGAAGAATGTAGCATGGACATTGGTTGAAGTAAGATTGAGCGATTAGTACCAAAA
GCTC
page-top