Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5836  (registered. 2012)
Contig Information
Length 900 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 6
Wh_r Root 2
Wh_SH - 2
Wh_DPA20 Seed DPA20 6
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 2
WH_XF Seedling, infected with leaf rust 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1621627|gb|AAB68035.1|| manganese superoxide dismutase [Triticum aestivum]
Score 436
Evalue 1.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5836
TTTTTTTTTTAGCGAATGAGTTTATTGGCCACGCAGGCACAGTAACAAGTACCAAAACGGACGGGCACTGTTGTTCGCATTAGACAGTAGTCCACCTCTA
TGCAATGTACAGACGAATCCCGACAGTGGAATAGTGCCCACTTTTATTACTGCATGTACAAAGATCCAACAGCGGGGAACTCAAGAGCGAGCGAGCGAAG
TACTGTCTGTCTACTCATCAGACAAATCACGCAAGCACTTTTTCATACTCTTCTCCAGCGTATTTCCAGTTCACCACCTTCCAGATGTTGGTCAGGTAGT
CCGGCCTCACGTTCTTGTACTGCAGGTAGTACGCATGCTCCCAGACATCAATTCCCAACAAAGGATGCAGGTTTGACCCTTTGGTCACAAGAGGGTCCTG
ATTAGGAGTAGTTTCAACTGAAAGCCTTTTGGCCTCTTTATCCAAAGCTAGCCACACCCATCCAGATCCTTGTAAAGCAGCACCCTCTGCATTCATCTTC
TTTATAAGTTTCTCAATAGAACCAAAATCCTCATCAATGGCCCAGCCAAGTTTGCCATGAGGTGCCTCACCACCACCCTCGCTAATGGGCTTGAGGTTCT
TCCAGAAGATTGAATGGTTAACATGACCGCCGCCGTTGAACTTGATGGCGCTCTGGAGGCCGACGACAGCGGACGCGTCCCCCTTGCTGGCGGCGGCGTC
GAGCTGCTCGAGCGCCTTGTTGTAGTTGGCGACGTAGGTGGCGTGGTGCTTCTGGTGGTGCAGGCGCATGATCTCGCCGGAGACGGCCGGCTCCAGCGCG
CCGTAGTCGTAGGGGAGGTCGGGGAGCGTGAACGTCGCCACGCCCCTGGCGCCGCCGAGCGCCAGGCCTAGGGTTTCTTCGCGGCCAGCGTGCGGAGCGC
page-top