Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5834  (registered. 2012)
Contig Information
Length 1103 bp
Clones alternative view 638 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 12
Wh_h Spike at heading date 5
Wh_r Root 1
Wh_SH - 35
Wh_DPA20 Seed DPA20 4
Wh_KMP Shoot grown under continuous light 13
Wh_KMV Shoot grown with continuous light after cold treatment 17
Wh_OKCS Seed DPA5 1
Wh_V4816 Shoot grown under cold condition for 16days 21
Wh_V483 Shoot grown under cold condition for 3days 22
Wh_VABA Shoot with ABA treatment 22
Wh_VHS Shoot with heat shock treatment 61
Wh_VWD Shoot grown with dessication 32
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 14
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 13
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 6
WH_XN Leaves, plant was grown at constant 23Ž 32
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 10
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 52
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 85
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 60
WH_XF Seedling, infected with leaf rust 55
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 16
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 22
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 8
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 14
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|290875537|gb|ADD65763.1|| putative carbonic anhydrase [Triticum turgidum subsp. durum x Secale
Score 519
Evalue 3.00E-145
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5834
TTTTTTTTTTTAAAAGGGTAAACTGTTCATGAAAATATTATTAAACTTATATATGATGTCTTTTGATCACAGGACGATCAAATTATGCATCACATGGTAG
TACAATTCCTCGTCAGAAAATGGTAAAAGAAAAAAGGTTCTATTGCTTATGGCGAATTCACATCGGGCCATCCCGGCATCCAGTACTGGAAAATAACGAG
TACGCACTCCATGGCATTGGATTCACATCGGTCGGTCGGACGGTCGGACGATATCTTGATATATGTACGCGTTTGTATTCGCATGTATATATAGGAGTTA
ACCGGTGGGGAAGATTTACTGCTCCCATGTCTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCAACGAGCTTGAGGGTTCCGTTGGACACACCCTCC
TTGACGAACGGGTAGGTCAAGAGGTTCTGGAGGGACACGTTCACGGCCTCCTTTTCGAGGACGGTGCACTGGTCATCGAAAGGCATTGAGGCGCACTCAG
TCTGCACCTTCTTCTTGGCCGGGAAGCCGATCCTGACCCAGTCCTCGACGAAGTGGAAGGAGTCGTCTGCGCCATCCTTGAGTGAGAGGAGAGCCTTGAT
TCCACCGCAGCGGCTGTGGCCAATCACCACGATGACCTCAACCTTGAGAGCACAGACGGCGTATTCGATGGCCGATCCAACACCAGCGTACTTGTTCTTG
CAGTAGGACGGGACCATGTTGGCGATGTTGCGGATGGTGAAGGCCTCGCCGGGCTCCAGGCCCAGGGTGACCGAGGGGCACACACGGGAGTCAGCGCACG
CGAACACCATGTACTTGGGCGCCTGGCCGGCCTTGAGGGGCTCGAAGAAATCGGGCTTCTTGTCGTAGACCTCGGTCTTGAACTTCTCGAACCCGGTCTT
GAGGCGCTCCACGGCGGCGTCCATCAATGCGGGTGCGACGGGCGCGGCCTGGACGGGGGTGTTCCTGATGAGCTTGGGGCGGAAGGAGGAGGAGTTGGAG
GGCGCGGGGGTGCCGAGGCTGGCGACGATGGTGGAGGAGCGGGCACGGGGCGCGACGGTTGCGTAGCACCAGTTAGCCGCGGCGGTCGACATTGTGCAGA
TGG
page-top