Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5815  (registered. 2012)
Contig Information
Length 2733 bp
Clones alternative view 345 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 3
Wh_h Spike at heading date 2
Wh_SH - 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 13
Wh_V483 Shoot grown under cold condition for 3days 3
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 16
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 49
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 31
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 34
WH_XT Roots, 18 day old plants were grown hydroponically 44
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 46
WH_XA Root 5
WH_XB Root 10
WH_XC Root, treated at 50 microM Al for 6h 12
WH_XD Root, treated at 50 microM Al for 6h 12
WH_XE Seedling, infected with leaf rust 19
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 12
WH_XV Leaves, plant was grown at constant 23 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 5
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222630284|gb|EEE62416.1|| hypothetical protein OsJ_17207 [Oryza sativa Japonica Group]
Score 914
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5815
TTTTTTTTTTAATAACATGGACACCAATTTCACATATTATTTAGGAGTATGCAAACATGCGGCCACAGCAAGGAAAGGGAATTTAGCATCATGTAACTAC
AATCTGCAGCGAAGGTCGCAATTCACAGTTCCGCATATGAAACAAGCTCACAACAAAAAAGAAATTGATGTTTCTAGAACGCATCGATTGAAAATTATTT
CAAAAACTTGCCAATTGTTTCAAGCTGGCAGCTGAACTCACATCAGAAATCACATGTGGATCGCCTTGTCGTAGGTGTTCATGCATGCCTCCTTCAGGGC
CTCGCTCACTGTCGGATGCGCATGGCACGTACGGGCAATGTCCTCACTGGATGCTCCATACTGAAGTGCAAGCACAGCCTCGTGGATGATCTCGCCAGCG
CCAGGGGACATTATGTGTACGCCGAGGATTCTGTCAGTTTCCTTCTCAGATATCACCTTCACCATCCCTTCGGCATCATCAATTGCCTTCGCCCGACTGT
TTGCCAGCAGGGGGAACTTCCCAACCTGGTAGGCTACACCAGATGCCTTGACCTGTTCCTCCGTCTTGCCAACGGAGGCCACCTCTGGGTGTGTGTACAC
CACGCCAGGTACAGTGTCATAGTCAACATGGCCCTCCTTCCCCGCGATAAATTCAACACATGCAACACCATCCTCCTCAGCCTTGTGTGCAAGCATCGGT
CCAGGTATCGCATCTCCAATCGCGTATACGCCCTTAACATTTGTCATAAAGCGATTGTCGACAAGGACCCTTCCGCCCTTGTCTGTCTCAACACCAATGG
CGTCCAACCCAATACCAGCAGTGTATGGGACTCTGCCAGCAGATACAAGGACAACATCAGCCTCAATGACAGTCTGCTCTCCACCAGCTGCAGGCTCCAC
AGTTAACTTGACACCACTTCCAGAGGTATCGACCCCAACAACCTTTGTCTTGAGCATGAACTTAAACTTTTGCTTCTCCAGCATACGCTGAAACTGCTTC
CTTATCTCTCCATCCATTGATGGGACAATATCAGGGGCAAATTCAACCACAGTCACTTCAGACCCTAGCCTGTTCCAGACAGAACCCATCTCTAGACCTA
TGTATCCAGCTCCAATGACCACCAACTTCTTTGGTATTTCTGTAAGTGCAAGAGCCCCAGTAGATGACACAATCTTCTTCTCATCAATTGTAACTCCAGG
GAGCGATTTCACATCTGAGCCAGTGGCAACAATTATGTTCTTCCCTTTGACGATAGTGCTACCACCATCAACTAAATCCACAGATACCTCTGACGGAGAG
ACAAGCTTCCCAAACCCTTTAACATACTCAACCTTGTTCTTCTTGAACAGGCCTTCGATGCCCTTTGTAAGCCCAGAAACAGCCTTGTCTTTCTGAGCCA
TCATTGCAGGCAGATCTACCTCCAGATTGGAGAACTTGACGCCATGGTGTGCAAAAGAAGACTTTGCCTCATGGTACATATGCGACGAATGCAGAAGAGC
CTTGGACGGGATGCAGCCGACGTTGAGGCAGGTCCCCCCGAGCGCGCCCCTCTTCTCGATGCAGGTGGTCTTAAGGCCGAGCTGCGCTGCCTTGATGGCC
GCCACGTACCCGCCGGGCCCGCCGCCGATCACGACGACGTCGCTCTCCTCCCCCGACGCGGCGTACCCCCGGCACGCGGACGCCCACGCCGCCGCGTGGG
GCCGCCGCAGCAGCACCGCCTCCGCCGCGCGCCTCCTCGCCAAGCTCGCCATCGCCATCTCGCGGCCGCGGAGGAACCGTTGATTCACACAATTGGTCAT
CGCGCTTGGTTGAAAAGCCAGTGGCGCGAAGCTACCGTGTGCCGGATTATGACTGAACGCCTCTAAGTCAGAATCCAAGCTAGCATGCGACGCCTGCGCC
CGCCGCCCGCCCCGACCCACGTTAGGGGCGCTTGCGCCCCCAAGGGCCCGTGCCATTGGCTAAGCCGGTCCGGCCGAAGTGCCGTGGCCGGCCGCCTCGA
AGCTCCCTTCCCAATGGGCGGTGGGCTCAACAGCAGAAAGCATTCTACCACCAGACCGACCGCACAGTTGAAGTGAGATCTGCGCTAAGGGTTCATCAGC
AACCATGAAGAGCACCAAGCTCGCGGCGATCCTGATCCTCCAGGCCGTCCTGGTCATGGGGATCCTCTCACACGTGAACGCCGACTATTTCCCCAAGTGC
TGCAACAACTGCAGGTCCTTCTCGGGGGTCGACGTCTGCGACGACGCCCACCCCCAGTGCCCCAAGGGCTGCTCGGCCTGCCGCGTGGTGACGCCGAGCC
CTCACAAGACGTTCCGGTGCGCCGACATGAAGAGCACCGTCGATGGCACCTGCGGCGGGCCATGCAAGAAGCACTGATCCGTTCAGGGCTTCAGGCTCAG
ACGAGGTGTGCCGCCTAAAATAAAGCTCAGATGAGATGAGCAGTCATGGTGCCTATGCTTGTGTGTGGGTCGTGCTATACGGCCAACAATATGTATACTG
CTATCGTCGTGTCTTGGTCAATGTGTTTTCTCTCTCGAGAAAGGCTGGTGGTGCTTGTACTTGTTCACCTATTCTCCGTCAATAAACACATGTGATGATT
GTACTTGTTCAACTATCCGCCGTGAATAAACACATGTGATGATTGTGCTTGTAAAAAAAAAAGTTATGTTTTCACGTCTCATACGAGCTGATGGNNNGCT
CTTTGAAATTTACCTTTCTACTTTCGGCACAAA
page-top