Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5805  (registered. 2012)
Contig Information
Length 1096 bp
Clones alternative view 97 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 17
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23Ž 9
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 11
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 9
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 3
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 6
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|9624495|gb|AAF90200.1|AF287276_2|AF287276_2 chlorophyll a/b-binding protein precursor [Hordeum vulgare]
Score 466
Evalue 2.00E-129
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5805
TTTTTTTTTTGCCTTGTTTAAAATAACACGGGTGATATCTTTTTTTTTTTTTTTTTAATGCTTCAAACTAGTAGTATGTTTTGCCATGTTTAGAATAACA
CGCATGGGTGATATTACAAGTACAGCCTCCATCGGAAGCCATGGGCGAATCCACAAGAAGAAAGTTTCACCACCGGAGCTTTAAGATTACAACACATTTT
TGCACTGTCCACCTACTCCTCCACACTTTGTACATCCTCAGTACCCCAAAATAACAATTCAGACCACCTGAAACCTCCCCGGTCGGTGAAATCGACGGAT
TTACTGGCCGGAGATGGTCTGGATGATGGTGGTGTGCCATGGGTCGGCCAGGTGCTGCTGCAGGTTCTCGAACGGGCCCTTGCCGGTCACGTTGTGCTGC
ACCAGGAACCCCAGGAACGCCAGCATCGCCAGTCTACCGTTGGCGAGCTCCTTCTCCTTGTTCTCGAGGGTGGGGGCGAAGTTGAGGGGGTTGAAGACGC
TGCCGGGGTAGCCGCACTCGTGGGGCGGGAGGCTGTAGCTCTTGAAGATGGGGTCCTGGTTGACGGAGCCCGGGTTCTTGATGTCCTGCCACCGCCGGAT
CTCGACGTAGTGGAAGAGGATGAACTCGATGACGAACAGCGTGGAGGAGGAGGCGAAGTAGGTCTCCTTGCCGGCGTCGTACCACTCGGGCGCGTTCAGG
AGCCCCGCCTTGGTCAGCACCTCCGGGATCAGCATCCCCGCCACCCCCAGCATCGCCCACCGCCCGTTCACCAGCTCCGCCTGCACGAACCACCGCAGGT
CCTCCGGGTCCTCCGCCAGCGCCAGCGGGTCGAAACCATTGTCACCCGCCAAGCTGCCGTCGAGGTAGGCAGGGGAGGGGAGGCCGGGGAGCCACGACCC
CTTGGCCTGGACGGCGACGTCGCGGCGTGTGGACTTGGCGAGGCCGACGCGGCCGGAGTCGCCCAGGAACCGGGGGCTCGACGCTGACGCCGCTGGCCGG
AGAGCGGCCACGGGAGCGCGGGCACTGACTGACGACATCTTGTCTAGAGAGCAGGTACGGCGCACCGCGGCAGGAGAGTGAGAGTGCGTCGGTGTG
page-top