Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4431  (registered. 2003)
Contig Information
Length 1137 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Homology (BLAST) Top Hit PDR-like ABC transporter, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 82
Evalue 0.247901
Total Hit Count 88
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4431
CCTACTTAAGTTGGCTAATTTCTTTCATACCCATTATATGATTGGCATGTCCTATTTCTCTCTTGGTTTCTTCTTCTTTCTTTTGTTGCTTCTTTGGAAT
TTTGTTGGTGTATTTTGGCTATTTGTTGAGTGTTTGGTGCTTGGTTTTCAGTTGTTCACTTTCTTTTTCTTCCCCTTCTTTGATTTTTCTTTTGGATGAT
CTTCTCCTAATAGACACCATATGGTTTTTGTGTTGTTTCCTAGGTACAGATTTTGGTGTCAATTCCTGGACCTTGCTGCCTGCATGGTCATCGGCATAGC
CAACCCGACGTGCCGGCGTTTAGCGCGGATGGCCAGATCTATGCGGCAGAGAGCATGGCCGATGCTGGAAGGGAGGTCTTGCCGCCGGCCTCCAAGCAGT
CGGTAGGCACAATGGATCCTAAACCTCCAGGCTGGATCAAAAGGGTGAGGATTTGGGAGGAAGCCCCTGTTTAGACACCTTGTCCCAGTCAAGCACGAGC
CGACGGCGGTGACACTGCATATGTTATCCAGGATCATGCTCAACGGTTGTGTCATCGGCGACAAGATCCACAAGATGCCATGGCGGTGGTTGCCCCGGGT
GTTAATGTAGAGGGCAGGAACCAGTAGCAGGTGAGCACCAAAAATCTCTGAAACTTTTTCTTCAAAATACAGTAACCAAGCTGCGTTTGTTTCGTGCACA
TACATAAATGGATGGCTCTTCTTCTTGGAGCCCCAAGTTGTGGGAAAAAAACCCTATTGCTACCACTTGCAGGAAAGCTCAACCAAAACCAAGAGATGTA
CATATTTATCCCCACAAGGCCACAAGACACAACTGTGTGTTGTAGGTAGCATCAGAAATTGAGTCGAATGGGATCAAGATGGAGCGGTTTGTTTCCAAAA
GGCACCACCTCTTTAATTTTCTGCTGGACAAGCGGATAACATGCTCCGGTCCAATTCGTGATTGGTGTTGATGCATCTCTAAATAATCTAATCATTCTGT
TTTGCTAGCTTGTGCCATGCATGTCAGTGAGTTCTGATGGGCCAGTGGCAGGGTAACCAGAATGGGTCTTTTTGCCTGTACAGTTCTTATAGGATTATCC
TTACTATATGTTTGAGTAAAACAACTCAAGTTCATGT
page-top