Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4415  (registered. 2003)
Contig Information
Length 697 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Homology (BLAST) Top Hit alpha-ketoglutarate decarboxylase [Nocardioides sp. JS614] >gi|119536633|gb|ABL81250.1| 2-oxoglutarate dehydrogenase E1 component [Nocardioides sp. JS614]
Score 92
Evalue 0.160628
Total Hit Count 59
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4415
CTCCGCCCACTTTGCCAAGTTGCCCAGAGGCTTGGGGGCTGCTGTCGCAGTAATTGACCACGGGTACCCCGAGGACGACTAGACGATATTTCAAGACATC
GGGGCTAGCAAAGCCCCTCAGTCCGATTGACCGGCCGATCCTGCCGGCTTCTCGGCCGCTCCTACCGGCTTCCCGTCCGACTGCTCTGCCCGGCCGACTG
CCGGCTGCCGACTGCGCCAACTTGCCGGCTGCCGACTACGCCAACCAGCCGGCTGCCGACTGCAGCCCGACCCGACATCGACGAGACGGATGTACCCGAG
CACTATTCATGCATCATCTCAGTCATCATGTATAGTATCACTTGTCCCCTCGCACTATTTATGAAGTGACCCAGGGGACAAGGATGACACCCACCATGCC
TTTGCCCATGCCACTAGTTACCTAGCTACCATACCTACATAGCTTACATACTAAGCTATCTCACACTATAAAAGGAGGCCTCATCCATCCATCCAGGATG
ATGGACACTCTCACGCACACACCCACGGCCAAGTGCCATTCGGCCACTAGAGCTTGCATGCTCATCCGGCCACCCGCATATATACGAGGCCAGATGCCTA
TGGCACTGACCTCAGATACAACTCTAGGAGCAACTCTGTACCAGATATACCAGATACACTCAGACATGCAGCAGTAGGAGTATTATCTCTCCGGAGA
page-top