Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4142  (registered. 2003)
Contig Information
Length 1252 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 1
Homology (BLAST) Top Hit hypothetical protein OsI_20321 [Oryza sativa Indica Group] (no hit)
Score 253
Evalue 1.38699e-20
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4142
ATAAGCTAGCATGTGAAAAGTAGCAGCACCAGTTACAGTAGAAAAGGCCATCTAGTTACTGAACTGGTCGTGCATGTACAAAGCACATAAACAGTGAATG
TTCAACACCACAGACACCCGAAACATTTTCTCTTCTTCTGCCTCCGATGCGCCCTGATCGATCGCTTTATCAAGATAGATATTGCACCCAAGAACTACTA
CCACAACCCAATCCATCATGAGACCCACTAAACACCATGTGTGGTTTGAAAAAATTCCGTTTATCAGTAGATTTAGTTTCGAGCAAGCAAGCAAGGTAAC
TATTTCTAACCCCTCCATATAAGAAAATTGAACGGAGGCTTAATCAGGGTAACCGAAGTTTTAAAAAAGGTGTTGTGTGTGCTGGATTTATGATGATTTA
GGTCTTGGAAGACCTGAACAGGCAATCATAGTATTGCAAGTAAGAAAATGTGAAACGTTGCTAATAACGTGCCTCATCTACCAGTAAGGGCTTTATTTTA
TACCAAAGTTTTAAGCAGCTACAGTTTACAATTCAAACCTATGACTGCACTCAAAGCTGCAGTGACATTTTTCATCTGGTTCAGCATCCCAATCTAAAGC
ACACAATAATTTCCTGCAATGGTGAGGCAGCTGAATCAATAACACGCGGACCAGATCGAGAGTTGAAACTCCACACTACAGGAAAACCAGAGCGATACAG
ATGGCTGAAGACAATATTTTATCCGAACAATATTCATTGCATCCACGCTTACCTCCCTCTTCCCCTGTAGCTCCAGCCCATAGCATTCCACAGTTTAAAA
CAGAGCAGATAAAGGGTGAGACAATACCTCAACAACAATTGCTCAACGAGTTAAGTGTCATTTAGTTATTCTTATATAAAATTACACTCTAAAGTATCTA
GGCTTCATTGCTCTTAACTGAGTACTCGTGTTCACTGACATCTTCTATTGCTAAATTGCTGATGCGTCATCACTCGTCGGTTTCACAGTTCAGAGGAAGA
AATGCAATTGATTATTTTTAAGTGGTTGGCTGACATATTGACCTAGCATAGATCAAGCAATTCCATGACAATCTTAGTATCAAGACTAACTTGTGCATTG
ATGTCAGTAGCACTCTGTTTTAGAAGGGAAATGCTTTCGTCTAGTGAAGCTTGTTGTCCAGCCTTGAAGCCCTCCTCTTTGGGGCTTCGGGATGCTGAGC
ACTCGCGGGGAGACATGGATCGTGCCATCACAATGCCCTTGGCACAAAAGAT
page-top