Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig4078  (registered. 2003)
Contig Information
Length 760 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_RDr Root of dessiccated seed 1
Homology (BLAST) Top Hit unknown [Zea mays]
Score 311
Evalue 7.79944e-27
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig4078
GTAGTTGGTTGGCGACAAACCTAACAACCTTTTTCTTCTTTTATATAAACACTCGCACGACCGCACAAAAAGCTACACATGTCAAGTCATCTTCACCACC
ACCACCAATCCGCTTCCTTCCTTCCTTCCTTCCAAGGTACACTTACTATAGTACTAGTAGTAGGATACATCTCAAGGAACAAGAGAACCACGATTACACG
CTATGGCAAACACAAATTATGATCCAAGATCGATCGATGCTACTAAGGGCCCAAAAGAATACAATACAGTGCTTCCTTTTCTCCTCTCCGGTGCAGCAAG
TCCCTTCCTTCCTTCCTTCCTTCCTGCCCAGTCGTTATCATACATACCTTCGACACCGCTTCGTCGTCTTGGTGGCAACATGGAAGCTTCTGGGCAGGCG
GTGTTAGATCCTCAGATGAATGAAAAACTACTGCAATGCAATGTACGTCTGACAACTGCTTGTTCCAGCATCGTCTGGTTTCATAGCAACCCAGCTAGCA
TGGCACCCGGGTCGTTATATGTCGCCGGCGCTGCTGGAGGCAGCTGTGGTTGTTGCGGAGCGGCAGGGGGGGCCACTCGAGCCCTCGGGATGTCGATCAG
ATGTTCCTTGATGTACTCCTTCAACTCGAATGTCAGATTTTGATCTCCTGATGCGACTGTTAGCCGGAGCTGACTTCTGTCTTGGGGATCTGTTTCAACT
CTCACCAGACAAAGCGCGGCATTGGTTGTCTCCGAAAAGAATGTANCACACGCCACCATG
page-top