Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig574  (registered. 2012)
Contig Information
Length 814 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 3
Wh_SHC Shoot grown with cold treatment 2
Wh_VHS Shoot with heat shock treatment 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218187817|gb|EEC70244.1|| hypothetical protein OsI_01028 [Oryza sativa Indica Group]
Score 191
Evalue 8.00E-47
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig574
CAAAAATATGATTGTTCTTCCAGCATTTCACCTTTCTTAAATTAACGAACTTTACAATTCCCATCAAAAGAAAAAAATGTATTCGTAAAGTAACAAAAGA
TAAAATCCCGCAGCATATTTGAATATACAATGTCTGACTCTTTCAGGAGGACAAGAAATTGGGAAAAAGGTAAAAGAAAATGAAACTCACATTTTATTTT
TTTAACTTAAACCAGCCTTCTTCTAAATACACAATACCCAGTCTGGGAACCTTGAGCGATAATCTTCAACATCTGCTGCATGCTAAGCAAAACCAGCCGT
GTGACCCAGGCAGCTATCAGTCAATCCTCGATGATATGTACGCCAATCCCATGAAGCCTGACATCTCTGTTCTTGTCAAAATTCTGAACATGCCGTTTCT
TTTAGGGTCTACTTCTTTGAACCACGAGCTGCTGCAAGGTGATCCGAGACAAAATCAAAAGCTTTAGTTTCATCTTTCTTAGAATTGCTCATCACAGCTA
CTTGATGTGGAGGTTGATTACTTGAATTGAAAATATCTGGCATCCCAGATGCATTTCCGCCACTCATTGAATTGAAAGCAGGATGCCCAAGTCCAGCATT
GAAATTTCCCAAGTTCTGTAGTAAGTGCTGCTGCTGAGCAAGAAGAGCTTCCATAGCACCATAGTTTAATTGCTGCCCAGCAAATGATTGACCAAACATT
TGTGGTGACAAGGTGTACTGCATAGGAACCTGTTGATTGAAGGAGCTTTGACCANNNNTACCATTTAGTGCTGCACCACTTGCCACATGGCTATTCTGAC
TGTTCATGTCAAAG
page-top