Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5738  (registered. 2012)
Contig Information
Length 904 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_r Root 1
Wh_SH - 4
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_SP 2
WH_XA Root 1
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|51039056|gb|AAT94293.1|| endotransglucosylase/hydrolase XTH1 [Triticum aestivum]
Score 420
Evalue 1.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5738
TTTTTTTTTTAAAAGTTTTTTTTTTGCAACGATTATCTATAATTTATTAAGGTTTGTTCATACATAACCGATTGATCACATGTGCACTCGTACTCTTTCT
CTCCAAGCAGAGAAACCCACAAGAACCCACCTTAATTCTCTCTGTAACAGTAACCGTAACACTCACTGTAACAATCAAATCCATGGTGAAATGTACATGA
GAAATGAACTAAAGGCAGTAACGTTTGTCCGTCTCGAATCGAATGGACAAACAAGAACATCGATCAATGACGAGGAAGGAAGGATGAAAGGAAGAAACTG
ATGGACGATCCATGGGGAGGATGGATCAGTTGCGGTTGCACTCGGCGGGGAAGCCGTTGGGGAAGCGCCAGCCGTCGGTGCAGTAGTCGTAGGACATGTA
CTTGCTCTCGGCCCAGGCGACGGTGCCGAGGGCCTTGCCGTCGAGCTCTGTGTTCATCCACGCGTCGCTGCCGGCGGGGCACGCCGACGAGCCGCCGTTG
CTGACGCAGCCATTGGAGGAGTAGCCGCGGTAGTTGACGACGAAGGGCGCCTGGCTCCAGTCGATCTTGACGTCGCCGTGGCGGGTGGCCCAGTAGCTGC
CGTCCCAGAGCGTGGCGTGCACCGTCATGGGCTGGCTGCTCGGGTACGGCAGGTCGTCGTACTTCTTGAAGGTCCTCACCGGCACGTCGTCCACCTGGAA
TATGATGTTCTTGGGGTTCCAGACGATCTTGTAGGTGTGGAAGTCGGCGGTGGGGTCGAACCAGAGGTAGAACTGGTGCTCCTTCTTGCCGTCGCCGCTG
GCCCACACGTTGGTGTTCATCACATAGGGGTCGCCGCNNNNNNTGCCCATGAACTCGATGTCGATCTCGTCGTGCCCGTCGCCCTCCCCGGACGTCAGGT
AGAA
page-top