Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5737  (registered. 2012)
Contig Information
Length 1324 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_CSEC Callus 1
Wh_KMP Shoot grown under continuous light 1
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XA Root 2
WH_XF Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115434736|ref|NP_001042126.1|| Os01g0168100 [Oryza sativa (japonica cultivar-group)]
Score 479
Evalue 4.00E-133
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5737
TTTTTTTTTTGATTGAAAAAGGAATGCCACAATGATCCATAATATATTACACCACACACATCATAGGGTACCAGTAGCTGAAGCAACTACAGAGCACAAG
CTTTTACCAGGACTACTAAGGAGTAGACCGAAGCTACATGAAGAAAGGGGAAAGGGAAAGGGATGTTTACATTACATGGACATACTGATTTTAGGCATCC
AGAGAGAAGGATCCAGCAAGCTGCTGGTTGGCTGATCACGTCGCCATCACCATCGGCCTCTTGTGGCCCTGCAGAACTTGCCGGAGCTGCTGATACCCGT
CACGGTAGTGCTCGAGCGAGAAGCACAGCTGCCTGATTGCCTCCCGCTTCCCCTCTGCGCTGTCGAACGCCATGAGCTTCTGCCTCTCAACCTCTTCCTC
GAGCTCACGCACCCGTGCACGCAGTTCTGCCACGGACTTCCGTGCGGCATCTGCCTCTGCTATCACTTGCACATGCTCCAGGTGTAGCTGATGCAAGTGG
CTATCCATCTCCTTCATCTTTTCATCACAAGTTGCGAGATCACTCAGCAAACCAGACACCTTATTATCAACTGCAGCTTTCTGTGAGGACAGTAACTCGA
GCTCTGTCTTAAGATTGGCAATATCTTGCTTCAATCCAGAGATCAGTTTCTCACTCTCAACAGATGCTTCTGCCTTTTCGGCATGAAGTTGCTTAAGCTG
CGCCTCTGTGGATGACAACTTGTCTTCAAGAGAAGCATTAGCTTCTGACAGTTGTAGGATCTCAGCATCGAGAGAGGACTTCTCAAGAGAGAATTTCTCC
AACTTACTAGCAATGGCATGTTCCAGATCCTTGACAGAGCCCTCCAACATCGATTTCTCTTGAAGTGCTCCTTCCAGATCAGCTTTGAGTTTCTCAATTC
TAGTTTGTAGCTCCACTGTTTCAGCCCTCGAATCCTCTAACTCCCTATGAACTTGCTCAAACTCGATAGCACGTTCCTCGAGCACTCTCTTCTCATTTGA
ATCATTTTCCAGTCTTGCTTGCAGATCCTTGATTACCTTTTGTAGCTTCTTAATTTCAGCAGATGAATCATCTAGGCTGTGAGATGTTTGTTCAAGCTCC
ATAACCTGTGCCTCAAGCTGCAACTTCTCTTCCGACAGTTTTGCCAAGTTCCCTTCCAAGTTCTTGACCACTTCTTGGAGATCTCCGATTTCAGTCTCAA
GAATAGACTTATCATAGGTATGCCTCTCAGATACTTCCTCAAGCTCCCGCTTGCATTTCTCAATTTCAAGGTCACGATATGAAAGTTGGGCCTCATGATG
CTTGGCTGCTAAGGCCATTTCCCC
page-top