Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5734  (registered. 2012)
Contig Information
Length 1057 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VSCB Liquid cultured tissue 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 5
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|2495156|sp|Q42843.1|HEM11_HORVU|HEM11_HORVU RecName: Full=Glutamyl-tRNA reductase 1, chloroplastic; Short=GluTR;"
Score 507
Evalue 8.00E-142
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5734
AGAGTATTATAGTACAGCTTGAAAATTGGGCTCTAACCACAGCAGCCACGGTAAATAATGTACACAGGCAGTTTTGGAGCAAACATGCTTCGCCGCTCCT
CTCTACAACACATTTGGAGGCTGCCATGGCTAATTCACGGCGCAAGAAGAACTCAGCAGTAAGTGGAGGATCAGAAAAAAAATACTGGGATTGGAATGTA
GCGACATTCTGGGAGCAGTATAAGTAGATATACAGACGGACAAGTATCTCCTGGTCTCAGCTTTGGGTCTTCTCTACCTTGGCCTTGATCTTCTGCTCAA
GGACCGCCTTCTCCGTGTCGAGGTTGAACATTCTGTTGAGGGCGTGCATGTTCTCAAGCGTTTCGTCCAGGGTGCGGCTGTCGCTGCCGTCGCATCTCAG
GTGCTGCAGTGGGCCGTGAAGGAGCTTGTTCACTATGCCCGTGCTCAGCTCCTCGATGGACCTTCTCATCTTCTTGTTGAGATTGTCTTCCCCGATCTTC
TGCAGGCACTTCTCGAGCTCCGATGCCCTGATCCTGTCGGCGTACGACCTCAGCTTTTTGATAGTCGGAACCGTCTCCAGCGAATCCCTCCATGCTTCGA
ACCGTTTCAGTTCTTGGGTAATGATTGTTTGGGCCTCCATTGCTTTCCTGACACGGTCTTCCTTATTGGCTTCCACCACCTCTTTCAAGTCATCAACATT
GTATACCCGTGCATGCTCCACCTCAGATACACAGGCACCGACATTCCTCGGGACAGATATGTCGACGAAAAGCCGAACACCACCCACAGCAAGAGAAATA
GGAGGAAGCGCCTCTGCATGCTCCTTCGTGAATAATAAGGATTCAGATGCGGTGCTTGTGAACACGACATCAGCTTCAGCAGCTGCTTCATACATCTCTG
TAAGTGGCCTGTACACAATCTCAATATCTTTCATCTCTTCGCGAATGGCATCCACCCTTTCCACAGAACGGTTCACCACAACAACCTTCTTGCATCCTTT
GGCAATCAAATGTTTGACCACTAATTTTCCCATTTTGCCAGCACCAATCAAAAGCAT
page-top