Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5728  (registered. 2012)
Contig Information
Length 823 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195621370|gb|ACG32515.1|| triose phosphate/phosphate translocator [Zea mays]
Score 246
Evalue 2.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5728
AAAATAATAAAAATTACATCTAGTTTCATAGACAACCTAGCGCCGACTAAAGCACTGGAGTGAGCCGAAAGCACACCTCTGTCATCGCCTCTCCCTCAAC
GGGCCGGGCAAAACTTGTTGTACTAAATATAGTCGGGAAGTCATCATGCTATGCTAAGACCCCACACGACCAAGGCACCAGAACATCAACCATCGACGAT
GAAGAGAACCACAGATCGGAAGGTACAACTTGTACACACACGGACAAACACTGGATCAACGGAGATTCAGCAAAGACCAATACCGACTGAATCCCAAGCA
GTCCGCCGAAGACACACATCCACATGCCCTCCAACAACGCAAGACGCACTGTCAGGACGGGGGCTAGGCGGAGAGGACCTTATTCCATCTTCAAGGAGCC
GCCGCCGCCACACCTTCCTTTTTCTCCTCAATCTTAGCCTTGATAACTGAGTATAGGGCAACACCAGAAATAGCAATGGCTGTGCCAATTCCAGTTTGTG
TGGTGATCTTGTTGCCGAAAATGATGATTGAGAAGCCGATGACAAAGACACGTTTCAACACGTTGCCGACGGCATGTGTTAGAGGGGCCACTCGCTGCAA
TGTGTTTGTTGCAACCTGGTTATAAAGGTGATAGAACAAGCCTGCCAAGAAAATATTGGAAACTAATTTTGCTAATCCAACTTTGGCAATTGCATCTTTA
AATCCATGCTGCACTAGTTGAGGTCCTTCAATAATGAGTGCTGGAGGAATGCAGACGATGAGAGCAATTATAGAGATATAGGCATACAGATTGGTGCTAT
CCATGTCAGTCATAGCTTTCTTC
page-top