Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig3552  (registered. 2003)
Contig Information
Length 920 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os05g0458100 [Oryza sativa (japonica cultivar-group)] >gi|52353447|gb|AAU44015.1| putative peptidylprolyl cis-trans isomerase [Oryza sativa (japonica cultivar-group)] >gi|76057837|emb|CAH55766.1| peptidyl prolyl cis-trans isomerase [Oryza sativa (indica cultivar-group)] >gi|113579294|dbj|BAF17657.1| Os05g0458100 [Oryza sativa (japonica cultivar-group)] >gi|215686485|dbj|BAG87746.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218196920|gb|EEC79347.1| hypothetical protein OsI_20211 [Oryza sativa Indica Group]
Score 671
Evalue 1.97838e-68
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig3552
GATCTGTCTATCATCGTCGCTCCCTCCACTCTGAATTCCCCTCCCCTTCTCTCGGTGAAGCAGGTCCTCACCGGCGCCCCCGCTGCCACGGCTCTCTCTC
CAAATCGTCGCCGATCCGAGAATTTCCATTCAACAGCAAGGTCATGGCAGAAACCATTGATCTAACAGGGGATGGAGGCGTTCTTAAGACGGTGGTCAGA
AAAGCAAAAGATGATGCTATAAGCCCATCTGACAGCCTTCCATTGGTTGATGTTCATTATGAAGGGACACTTGCTGAAAATGGCGAAGTTTTTGACACCA
CACATGAAGACAATTCTATTTTTACATTTGAAGTTGGCCAGGGAGCTGTCATTAAAGCATGGGACATAGCCTTAAGAACTATGAAAGTTGGCGAGATTGC
AAAAATAACATGCAGGCCGGAATATGCGTATGGAAGTCCAGGCTCGCCACCAGAGATACCAGCCAATGCAACACTCATTTTTGAGGTGGAATTAGTGGCT
TGCAAGCCAAGGAAAGGTTCAAGTCTGGGCAGTGTATCTGATGAGAAAGCCAGGCTAGAGTAAGACATCTCCAAGTGTTTCCTCTTTTATATTTATTAAT
GCATCAAGTACCCAATAATCAGACGGTGGTCAACAAAATACTCAATGAAGCTGATCTGTGGAGGTTGGCAGTTGGCAGGGAGCTAAGGAATTGAGAACTC
TGCCTCTGAATGCTCGTCCACCCCATAACATCTCTAGCCATAGCTTTTTTAATCCTCCATTTTTAAGAGTTTTTGTCCTTTTTTTTCTGTTTCATGGGGA
TGGTGGAGCTTTTGCTGTTTTTTTGGTCAGTAGTACTGTTAAGCCAGTTTTGGCACTTTTTTCTAATACAAAAATTAGTACCCAATAATCATGTTAAACA
GCATGGACATCATATGAATA
page-top