Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5679  (registered. 2012)
Contig Information
Length 652 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 6
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 4
Wh_VHS Shoot with heat shock treatment 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_CA 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115435970|ref|NP_001042743.1|| Os01g0278900 [Oryza sativa (japonica cultivar-group)]
Score 174
Evalue 6.00E-42
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5679
TTTTTTTTTTTTTTTTTTTTGGTAAAAAATTAATTGCATTATAACCGATTGCGTGTTTCAGAACAGAAAAATTGTACAAACGAAACAAACACCAATGCAT
TAGAGGAACGCAACACGTAGGTTTACAGAGGAATGGTACGGACCAGCTGTCCGACATCATGTGCCGGTCACACGTTCTTGAGCTTCTTCATCTTGGACGG
TGGCCACCTGCCCTTCTTCCTCAGCCGCCTCTTTTGGACGAGCCGCTTGCGCCGCTGCCTCAGCTTCTTGGCCACCTTCATCCGTGCCCTCTGCTCCAGG
ATCATCCGCTGCTTGGACTCGAACGGCATGTCCTCGATCGAAGCCACTGGTTTTGGCTTCTCTGGTTGCTCTGCCGCATCAGTTGGACCAGCCTCTGCAG
AAGCGTGGACAACCACGGGCATCTTCTTGGCAAGAGAAACATGGCTGACTGAGGCGCCAGTCTTGCACTGAAGTCTCGAGGCGAGGTAAGGGAAGGCATT
ATTGCTGGCGGCGGTGGCGGTGGCGGTGGAGCTGGAGAGAGCTCGGGCACGAGGAGCGGAGGAGGGGGAGGGGGCGAGGAAGGAGACGGTGGGGGACAGG
AGGAGCGCCATGGCTGTGGATTTGGGTTCCGGCCTATCCTATGCGGAGGAAG
page-top