Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5676  (registered. 2012)
Contig Information
Length 1320 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHDr Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 15
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115469692|ref|NP_001058445.1|| Os06g0694800 [Oryza sativa (japonica cultivar-group)]
Score 240
Evalue 3.00E-61
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5676
GCAAATTTATACACACTTTCTGATTCTCATTGCTCGTTCGATATTACTATGTTTACTTCGAAATTACCATTGACAAGAGCAAAATAGTAATCTCGCTATA
TTACAAGGGTCGAATGACATTACATGAACATTCGTATCATTTAGTCGTCGTAATCATCGTTATCCCTGCGGTTGAGGAACCGCCGGACGGCGCCCACGAC
CGCCCCGCCCACAATGAACAGGACGAGCGTGTCGAAGCCGCCACCGACCCCGAGGGCGACGCTCGGGCCACCGTAGAAGCCGAACGGCGACAAGCCGTAC
CCGCCATAGCCACCGTAGCCGTAGCCGCCGACCAGCGGTGGCGCCACGCCGGGATTGACGTAGATGTTCGTCCTTGAGTTGTTTATCCTTGGACCGGACG
AGCGCGGTGCCGCGGACCGAAACGCCTTCCCACCGATCCTGCCGCCGGACTTGCCCGCCATGGCGTCGTCGACGGGCGCGAGTACGAGCACGCCGGCGGC
CATGGCGACCATCGCCAGCTTCCCGAGATTTTTCAGCTCGAGGTTTCCAGCCCACGACGGAGGCGCGTCCTTCTGGTCGGAGGCCCTGCAAGAAAGCCTC
GCCGATGCCGGCCTAATTGACGACCTCGTGAGCTGCGGGGCCGTGCATAGGGGCCTCCCTGTGAGGGAGCTCTGGAGAGATGTGGGGGCTAACGCCATGG
CCGTGATCTCCCACTCGGCTCCTAGCTTGCTTGCTTTGCTTGCTCTTGCTATGTCTTCTTCTTTCTCTGAGTTCTTGATTGCTTGCTGCAGTCTGAGATG
AAGACGCACCCACGCAGCACGCACGCCATGGCCGCCACCGCGTCCTTGTCCGCCGTCGCGGCGCCCCTGTCCGTCGCCGGGCTCAAGAAGGCCGCGTCGT
TCCGGCCCCTGCCGGTGGCCAGGGCCGGCAGGCCCGCGGCGAGGATGACGGCCGTCCGGGCGTCCTCCGCGTCCGTGCAGGAGAAGCTCACGGCCGGGCT
GACCGCGGCGGCCGTGGCGGCGGCGCTGGTGCTGCCCGAGGTCGCGGAGGCCGCGTCCCCGGGGCTGTCCCCGTCGCTCAAGAACTTCCTGCTCAGCATC
GTGTCCGGCGGGGTCGTCTTCGCCGGCATCGCCGGGGCCGTCGTCGCCGTCTCCAACTTCGACCCCGTCAAGAGGACCTGATCATCTTACTGGATTCTCA
TGGCAGGTCGCCTCGCTTTGTATCTCGATGAATCTCTTTGCTGTGTTTTATTCGGAGACTCTGTACGTAGAAGAGNNNCATGACAATGGAGTTCTGATTA
ATGGCTGTGTAAAAAAAAAA
page-top