Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5668  (registered. 2012)
Contig Information
Length 1082 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242073132|ref|XP_002446502.1|| hypothetical protein SORBIDRAFT_06g017010 [Sorghum bicolor]
Score 511
Evalue 4.00E-143
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5668
GGTACAGAATATTTACATTGCGGCGTGGCGCACATGAGCAGCCGCGCTTTCGCGTGAACTATGCACCTCTCAGATGCAGCTTCAACATGATCACTTCCAT
GAGAACTAACTATGCACCTCTGAGTTCATGTGATTATGTGGACCACTCATTGCTCCTTTTGTGCCTCTGGGAACAACTGCAGCGCTTGCGTCGTTAGTCG
CTTCGCGACAAAGAACAAGGGTATTCTATTCAGTTTCCCTCCATGCAAAGATTTCAGTTCATCAATGGTTTGCTCTTCTTGTGTACCAGCAGCTGTCATG
ACAAACAGTGGGTATAGTATTGCCATCACACCATAACTTGTAAGAGGAGAGAAGAAGAAAATCGGAAGTACACATGGACTACCAAATCCGGCAAAGAAAG
CCCAATTTGACTCAAAGAAATCAAGCCGGTGGTTCAGGCTCACTGCAAAGAAGTTCCACTTGTACTCGAAGCAGTAGTAGGCATACATCAAAGACAGTAA
CATGAAGTTCATTGCCTTACCAAGGTAAGGTATGCAACCAATCACTGTAACCTCAGCAAAGAAAATAGTCAAAAGAAGTATCGAATAGACCTGCTCTCCA
ACACCAATCGCAACCCCATCAAATCCTTCAGGCCTATCTGCTGATACAGATGTGCTGTGAGGGTCAGAGTCAGATGCTTGACTTGCATCCAGCTTCTTAC
TTTTCACAACAGCCAAAGCATGCTTAGCAATGTCACCATACCAAAGTGTACTTATTATAAAGCTGAAGATGTAGAGGGGATAAAACCAAAATACATAGAA
AATCTCGACAAGCCCCGAACGTAAGAACGAATACAAGGCAACAGCTGTTGTGTGATCACATAGATGTTGTCCCCATGATTGATCGCATTGCTCGGGCAGT
ATCCATAGAAGAGTTGGAATGACCACCGATTTCAAGGTTAGCAAGCTCCCCAGGAAGATGAACCCGTTGAGCAGGAAGCACTGAGCGATTCTGATCGACA
GAGCCCTGGAGCTGACGCAGAAGGAGACGACGCGGTGGAGACGCGCGGCCTGGAGGAAGCCGGCGAGCCAGAGCACGGCAGC
page-top