Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig3134  (registered. 2003)
Contig Information
Length 623 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Homology (BLAST) Top Hit hypothetical protein [Vitis vinifera]
Score 86
Evalue 0.627638
Total Hit Count 8
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig3134
GACTTTTCCTTCTCCGCCTCGAGTTGCTTCTTCCTCTTCCTCGCATGGCCGCCTCTGCCGCGGCCATTGCCTCGCTGCCCCCGTAGCCACCGAGCTCACC
ACGCCCAGCCACCTCGTCTACGAGCTTCGCCGACGTCCACTCCTTCGACTATGTCCACCAGTTGGAGCCGGTAGCCCCTGGATCGCAGGGATCGATGTCG
TCTTCAACCTCCAGCCACCGCGACATCATCGACGAATTCATCGCCGTCGCTCCACAACCCGACCTTCCCGAGCTCGCCTACGACATCGCGACTACGAGAC
CGACGATGTTGCTGCCCAGTTCGACTACGGAGTTGATGACCCCTCCTCCTTGCCAGAGCAACCAGGATCCAGACGCTACCGTCGACGACGACTACTACAC
TAGAGGAGCCTACTACTACGTGCAGGCCGCTGACGACGACCAGGAGTAGTTAGGAGGATCCCAGGCAGGAGGCCTGCGCCTCTTTCAATCTGTATCCCAG
TTTGTGCTAGCCATCTTATGGCAACTTGTTTAACTTATGTCTGTACTCAGATATTGTTGCTTCCGCTGACTCGTTTATGTCGAGCACTTGTATTCGAGCC
CTCGAGGCCCCTGGCTTGTAAAA
page-top