Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig3080  (registered. 2003)
Contig Information
Length 449 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Homology (BLAST) Top Hit hypothetical protein OsI_08696 [Oryza sativa Indica Group]
Score 375
Evalue 9.89384e-35
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig3080
CCGACGGCGTCAAGAGCTTCGGCAGCTCGCTGTGCATGGCGTCCATCTCGCTCGGGAACTACGTGAGCATCATGCTGGTCAGCGTGGTGACCAGCCTCAC
CGCCGGCGACAGGAGGCCTGGGTGGATCCCGGGTAACCTCAACTCCGGCCACCTCGACAGGTTCTACTTCCTCCTCGCGGCGCTCTCGCTCGTCGACCTC
GCCGTGTACGTGGCCTGCGCGATGTGGTACAAGGGCATCAAACTCGACAGCAACGAGGAGAAGGGAAAGGTGCCTGTGCATGTTTAGGGCCTTTTTCGTC
CCTTGAGGTATCTATAAGTGGGCATGCTATTGGTTCGGCCAACGTACTGGGCTGCCGATGCGCTTTCCCGTAGTAAAAATAATAAGTATGTCATCCTGTG
TTTGCTGCATANGCCCATGTTGCTTTCTGTCCTAGTTTCAAAAAAAAAA
page-top