Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5630  (registered. 2012)
Contig Information
Length 1564 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 3
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 11
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23Ž 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|62736388|gb|AAX97504.1|| putative leucine zipper protein [Triticum aestivum]
Score 830
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5630
TTTTTTTTTTCTACAAAATCGGATGCTATATTGCTATTTAATCAAGTATCGACACAAGTTACATAACAACTTCAGATATGCTTCTCCACCTGAAGCAAAA
CCGGAACACATGCTCTGATGCAGTTCACTGCCACTTACATGTTGATGTGACTAAGCAAAAACTTGCCGAGTTTTAATACTTTACAGATGAGCACAGGAGG
ATGTAGATCCTGTTAATTAACCATGGATCATGTGCTCATTCAGAGACTCTCGAGGAGCATGATGCATGATTATGTCTGAAAAGAAAGGCATAGATGGATC
CTTCTTCTACAAATTCAGTAGACAAGCTTGGGCTCAAACTCGGCAAAATCAACGGAGCCAGACTCGATTGGGGGCATGAGGTACGCAGCGATGATCTCAG
ACACTAGTTGGGCAATAAGAGGAACCCTCTTCAGGTTCTTCACCAGGGGCATGTCGTTGGACTCTCCTATAGAAATGATCTTCAGGTTGATATCTACCAT
CCTGTCTAGCTTCCTCTTGAATTCAGGGTTCTCAACATCCGGTACAGCAGGGAAGATCCTCGCCGTCGTGCGGTTTGTCTCATAGATGACATGCATGTCG
AATTCTTTGGTGTTGAGACCAATTCCTTCGTAGAAGGCACTACGTTGGCAGTCATTCAGGTACATGGTTATATACACCGAGAGGCAGAAGAAGCGTGACC
AGAGCTTGGCCTTCCAGTCATTGAGGAACTGCGGCTGCGCCTTGAGCAGCGCGGAGAAGAAATCGCCATGCCGGTTCTCGTCCTGACACCAGTTCTCGAA
GTACTTGAAGATGGGGTACACCTGGTACTCCGGGTTGGCCTTTAGGTGCCTGAAGATGGTGATGTACCTCCAGTAGCCGATCTTCTCGGACAGGTATGTG
GCGTAGAAGATGAACTTTGGCTTGAAGAAGGTGTACTTCCTAGCCTTGGTCAAGAAGCCGAGGTCCAGAGCCAGGTTGAAGTCGGACAGCCCCTTGTTCA
AGAACCCAGCGTGCCGGGCCTCGTCCCTGGACATGAGCGAGAAGATCTCAGCCACCACCGGGTTGGTTTTCTTGAGCCTGCGGCCGAGCTCCTTGTAGAG
GAGGAACCCGGAGAACTCGGCGGTGCAGGAGCGCTCGAGGAACTCGACGAAGATCTGGCGGAGCGGGCCCTGCATCTTGTCGGCAGCTTCCTTGAACTCG
GGGTTGCGGATGAAGTGGGTCTGGTTGTAGTCCGTCTTGAACTCCTGCAGCAGCGCGTCGAACTCGTCCTGGTTGAGCTGCTTGTTAATCTCGGCGTTGA
ATAGCTGCTCCATCTCGTCGAAGTCCGTGGTGTAGAAGCGCGGCGTGAGCAGCGACTCGTTGACCTCCGTCTTGCCCCGCTTCTTGGGCGAGCCGGGCTT
CGCGGCGGGTGCGGGCGGCGCCGCGGCGGCGGCCCTCACGCGGAAGCGGACGGCGCCCCGGCGCGCGGGGAGAACCGGGAGGGGGGAGGCCGTCTTGGCC
GCGATGCCGTGGTGGTGCATTGCGGGGTTGAGGAGGGAGAGCTCCATGGCGGACGCCATCCTGT
page-top