Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5613  (registered. 2012)
Contig Information
Length 1125 bp
Clones alternative view 142 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 11
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 4
Wh_oh Pistil at heading date 2
Wh_r Root 2
Wh_SH - 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 6
Wh_EM Dormant seed with water absorption 14
Wh_EMI Dormant seed with water absorption after breaking 17
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 7
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XN Leaves, plant was grown at constant 23Ž 10
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_SP 1
WH_XA Root 4
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 12
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XV Leaves, plant was grown at constant 23Ž 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195611406|gb|ACG27533.1|| cation transport protein chaC [Zea mays]
Score 387
Evalue 1.00E-105
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5613
TTTTTTTTTTGAAGCAAAGCATCACAACTCAGCGGCGCAGAAGTGCTGAAGTCGCCAAATGCATTTATTATTAGGGTATCACAAGGGAAGCAATAACACT
TGAAGTCTTAGGCTTTCGCATTAGCACTCTGGAAGCTACAGCCTTTGCCACAATAGTTGCCAAAGAAAATTAGCGCACACCCTCAATGGTGCCAGAGCTG
AAGTAAACCACAGATCTTTCAATGGTAGAATGTCAAGAGTGAGTGTGGTCAGAGGAAAATGCCATCTCTTTCGCTGATCCAGCCGTGCTGCTCTTCTTAC
TATGTTGAAACCGCAACGGTGCCCTCAGGAAGAGCAGAGATGTGCACAACAGGTGTATGCGATTTTAATGGTATGTCGGAGCCGGTAACCTTCTTCTCCG
TCGACCTGCTCAGCACCTTCCTCACCTCATCCGCAAGCACAATGATCGAGTCGTCTTCATGGCTTATATTGGACAGTGCCTTCTCCATTGAGAACAGGTA
GTCCCTATTATATCCATTAGGGCCACTGGCTGTAGCAATTTGCCTTGCCATATCCTCCAAAGCAGCAGGGCCAAGATAGTATTTGTTGCCAACTGGATCA
GGAGTGGATACGAAAACTAATACATCCGTCACAGCTGGTTCCAGAGAATTTCCATCCTTGTAGAAATCCACAGAGATCTTCTGGTCATACTCGCATTCTC
TTCTCTCCAAGTACTGCATTGCTTCTCGCTCTTTTTCTAGACCACCTTTGACACAATAAGCAATTCCCCAGCATATGGCTTCATCTTCGGATTCAAGGGT
GCAGGTCCTGGCCGGATGCTGTGGTGTGCCTCTATGGTCAATGCAAGCAAGATTAAACGTTCGCTTGTATCCCTTGATGAATCCCAGGATCTTCTCGTCG
AAGTCGAATCCGGGGTTCCAGATCAGGGACCCATACCCGAAGACCCACAGCACCATCCTGCTGCTGCTTTTCCCCCTGGCCGGAGGAGGGACGCCGGAGA
GAATGCCGCGGGTGGGGTCGGCGGCGCGGGGGGGGGAGCAAGATGGGGATTTGACTCTCCTCTTGCCTCGCCCGCGTCTCCTCTCCTCCGCCGGCCGGAC
GGACGGATGGGGGTTTCGTGCCGAA
page-top