Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig2684  (registered. 2003)
Contig Information
Length 804 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit RecName: Full=Probable L-ascorbate peroxidase 3; AltName: Full=OsAPx03 >gi|37030052|gb|AAQ88105.1| putative peroxisome-bound ascorbate peroxidase [Oryza sativa (indica cultivar-group)] >gi|116308894|emb|CAH66026.1| H0515C11.2 [Oryza sativa (indica cultivar-group)] >gi|125547320|gb|EAY93142.1| hypothetical protein OsI_14949 [Oryza sativa Indica Group]
Score 229
Evalue 7.77971e-23
Total Hit Count 303
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig2684
ACGCACGGGCATTTATACTAGTATTACATGGCATGGTAGCATCGTTCACTGTATCAACAGATTAGCTTACAACTACGAGTGCACAACATCTCAATGGACG
ATTAACTTTGTTCTTCAGAACCCATAACTGAATCGCAATCGTCTGAACATGGAGACTTGCAGTCTAACCACTGAGCCTTCTCTTTGATTCAAAGATGTAA
GCGCAGGCGATGACGACAACCGCAACTGGGAAGACAATGATAGTTCTTATGACAGCCCTCTTGGCTTTGTCTCTGCATGTCCACGCCAGTAAAGTAGAGC
TTGGAAAGCTTCTTGTGCGACTTCGCGTAGTCCCTGAAGAACGCGTCCTTGTCTGTAAGCAGCTTCATGAGTCCGTTGGAGTCCCCTTTCAGAAGCTCAA
TGAAGTAGGAGTTATCAAACTTCAGAGGATCTTTTGTCCAAGTGTAGTCGAATCCCGAGCTATCCGGAGGAGCTTTTCTCCTAAAACAGAGTATGTCCAC
CCAAGAGTGCTTCTATGTCCTTGTTGGTTAAGTCCATTCAGTAGATGAAATCCCTAAGGTGTGAAGCACCTCACGTTCCAGCTCAAGCCAAATGTTCTTC
TCTACGCTCCTTTTCTCCATCATGCGATAGGCTGTACTGCTGCAATCTATCTGCTCTCCAAAATTTTCAAATCTGCTAGGAACAAGTTTCATCTGCTACT
TCAGTACAGACAGGTTCTTCTGCAACAGTAGCTACATCTTCTGACTCTTGTTTCTCAGATGGAGCAGCTTGGTTGTTCTTACCGTGCATTGCCTACAAGC
CGTC
page-top