Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig2677  (registered. 2003)
Contig Information
Length 752 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Homology (BLAST) Top Hit PREDICTED: similar to potassium voltage-gated channel, subfamily H (eag-related), member 3 [Danio rerio]
Score 85
Evalue 1.22281
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig2677
ATGATTATGAATCATGAACATATTCACCCTCAAGCAAGAACATATTTTCCGAAAAACAAAGAATGCAGCAAAAGGGGCTATGGACGCCATGCCGAGCGAT
CGCAGTAGACATGGATCGCGCCACCACAATGCCCTTGACACCTAGGATTTTAGCACCTATCTTGGAAGGGTCTGACTGCTCTAGGGACATCAATCCACAA
TATCCCCAACCACTCAGAACCAAAACAATATGCCCTATCTTCAGTTTCAGACTTCCAGTCAACAGAAACCTGCTGCTTGCACTCCTTGACGACCTGCTCA
TTCTCCCCGTCGTTGGCCACCTCCCCTCCCCTGCAGCCACGCCCCATTGCGAAGGAGCGCCGCTGCTTGCACTCCTCAATGGCATGCTTCTTCGCCCTAT
TGTTGTCCGCCTCTCACTCCCTGTAGCTCCACCCCAAACAGCACAAGGTCCCAATTCATATTCAGAGCTATTTGAAAAGTTTTGGTCCCAAATATCGTTT
TCACTTTTAGTCCCAACAAAAATATAGATTTGTTCTGCATGTAATTTACATGACATGACGATGCCATCAACATATCCATCCATTACAACATGAACATTTA
TATTTGTTCTACGGAAAACAGCTGGATATATAAGGGAATGAACTAAACCGAAATAAAAGAAAACATGGCAATCTCTTTGCATAATCTGGAATGCAAAAAA
GCATAGCTGCCAACTCAAGCTCTAAATTAACCCAGACCTTTGCTACTTCTAG
page-top