Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig560  (registered. 2012)
Contig Information
Length 1300 bp
Clones alternative view 57 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 8
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 4
Wh_CSEC Callus 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Wh_VSCB Liquid cultured tissue 1
WH_XT Roots, 18 day old plants were grown hydroponically 8
WH_XA Root 6
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226502398|ref|NP_001141003.1|| hypothetical protein LOC100273082 [Zea mays]
Score 534
Evalue 1.00E-149
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig560
TCCCCCCGCTCGCGCCGCCGCTCACACCCCTCCCTCCTCCTCCTCTCCTTCGCGGCGCCACCCGGACGCTCGAGCCCCCGACAGCCATGGCGGCAGCGGC
TGGAGAGGCCCCGCGGGCGCTGTCCCAGAAGGAGCAGGACATACAGATGATGCTCGCCGCCGACGTCCACCTCGGCACCAAGAACTGCGACTTCCAGATG
GAGCGCTACGCCTACAAGCGCCGCTCCGACGGCATCTACATCATCAATCTGGGCAAGACGTGGGAGAAGCTCCAGCTCGCGGCGAGGGTCATCGTCGCCA
TCGAGAACCCCCAGGACATCATCGTCCAGTCCGCCCGCCCCTACGGCCAGCGCGCCGTCCTCAAGTTCGCGCAGCACACCGGCGCCAACGCCATCGCCGG
GAGGCACACCCCTGGTACCTTCACCAACCAGATGCAGACCTCCTTCAGCGAGCCCCGGCTGCTCATCCTCACCGACCCAAGGACCGACCACCAGCCCATC
AAGGAGTCTGCTCTGGGGAACATCCCTACCATTGCCTTCTGTGACACCGACTCTCCCATGCGATACGTCGATATCGGTATCCCAGCAAACAACAAGGGGA
GGAACAGCATTGGCTGCCTCTACTGGCTCTTGGCCAGGATGGTTCTGCAGATGAGGGGCACCATCCTGCCAGGGCACAAGTGGGATGTCATGGTTGATCT
GTTCTTCTACAGGGACCCTGAGGAAGCCAAGGAGCAGGAGGATGAAGCTGCTGGAGCCCCAGAGTATGCTGCCATCACTGATTACGGAGCAGCAGCTGGT
CAATGGGGTGGTGACCAGTGGACCTCTGATGCGCCTGCTCCCCCACCTGTTACTGGTGGCGAGTGGCCGATGGCTGAAGCTCCAGTTGCTGGTGGCGATG
GATGGGATGCAGCAGGGGCACCTGTTGCTGTGGAAGGTGCCGTCCCTGCTCCTGTTGTGGCTGCTACTGGCTGGGACGCCGCGGTGCAACCCCCTGCTCA
AGGCTGGGAGTAGACTAGGATGTCCCCTTGAGATGTCTTTGCGGCTTAAAGTTCATATTTTGTGAGGCATGAATGGATATCTAGAATCTGATGCGATCTG
CTATATCTACCCTATGGACAAAAAACCCGTGTTTTAGGATTTTCTAGATGAACTTGTTATCTCTGCTATCGACACTGTGATGAGGGAGAGGGAGACTGAA
AGTTGTGTTATAAGTTTGGCTTTCAACTTGTCTGTCTTAATTTTGCAGTTCTTATACTTGATGTTTCTATGCATTTTTGCTGGCTGTATCAAAAAAAAAA
page-top