Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5592  (registered. 2012)
Contig Information
Length 1050 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218196557|gb|EEC78984.1|| hypothetical protein OsI_19471 [Oryza sativa Indica Group]
Score 418
Evalue 5.00E-115
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5592
AAAGTCTATATACATACCATTTAGAAACTAGGGAGGGAGTACAAACTTATGTCTTTAGCATGGTTTATTATCGTGTTACCAAAATCACTAGTTGAACTCC
ACTAGGTACTACCTATCCGTTACTTTCTTAAACTCTTGGTACACAATATCAAGCAGTAAAAGGAAAAGACATACTAATGCGTTGCATCTGAACATCAAAT
TAAAATAGAACAGACGCTGACACTATTTTTTTTTTATCTACTGATTATTATAGTTGCTTTTCTTTTTTTTCCTTTTGGTGCAGAAAGTATCGTGTCAATT
TACATGGTTTAGTGTGAGCCTATCTACAAAGATTCTAAGAAGATCCAGGAACAGGTGCAGGTGGGATCCTGAGCAGCTGCTGCAGCAAGCGGGCTGCAAG
GCGCTGCGAGACACCTCCAGCAATACGAGAACCAAACATACGGGCTTCACGCTCTTGTAGCACCTGTACAATTGGCTGCAAAAGACTTGGATCAAAGGTA
TCAGAGGATCTCAGAAGACCCCATATTCTGAGAACAGTGTCTCGTAGCTCCAACATTTGTTCCCGCTCAACATCACTTATCTTAAATGGTCCAGCTGGAT
TGCCATTGGATATTAATGGCTTCAAAAATTCTGGAGCTGCGTTGTATGAATCAATCAGTGTTCCGAAGGTGATGGCTTCTGTGACACGAACCGCTTCTTT
CACAACTAGCACTCTTAAATTCTCCCCATCTGGACCAAGTAGAAGTTTCAAAACCGGTTGTAGAGCATCCTTCGCTACAAACTCTCTATCCTGGCGTCCT
TGAACAAGAAGATTTTCAAGCCTATTCCACCTGAATTTTTCATCCTTGAATAGCAGCTCAATCAGAGCATCTCTGAGATATGGATTGGGATCTGTGAGTA
ATCTTTTAGCAAAGTAAGGATATGAGGCAGCAAGCACCTTAAAATTAGGATCGGCATAGAGTGCCAGACCTTCCAGCACAGTGAGTGATCGCAGTATCAA
CGCATAGTNNNCCGGTACATTGAATGGGTACTGATAAAGAACAGCGCCTA
page-top