Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig2486  (registered. 2003)
Contig Information
Length 673 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Homology (BLAST) Top Hit mCG120852 [Mus musculus]
Score 86
Evalue 0.744861
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig2486
CGTGCGCGCTCGTGTGGCTGGGAGTGGACTGCATCCCACAAGCAGCAAAGGCTTTTTTTCTTTTCCTTTTGGATTTTGGATGTGCAGAACTGTTGCAGTT
CATTTGAATCTTTTTGAAGCTCACTGAATTTTATTTTGTAGTTCACCCATCCTCCGCTGCCGCATCCTATGCTAGCCGCCAGTGTGTGGGATGACGCTGG
ATGGGGGCGAAAAAAGTAAACTACGACTGAAACGCCTAAGAAGGTTCTAATGGCCTGAAGATCAAGCAGGTGATCTTATTCCTCCCTGCTAATGTCCATG
TGTCAGTGTCTTCCACCATCCTAGAGAGAGCCTGCACTGGTGTTGTCCGTTTGTTCTCAAAGAAAAATCACGATGAGGTACCTGTGCGAACAAAATAGGA
AAAACAAATCTCCCCGTATATGGATTGGTGGGTGAAAAAATGGGGCTGAGAACCAATACGGAGGGCATGAATTGTAGTAGTGAGATGGGATAACAGTGCA
TCCGTGCGGGCGTGCAGTTTGGCGGCACGGCGCGTGTGGTACACTGGTTCCGGTGATGCTGTTCGCCGGCGTACTCCAGAGTAACAGTTTCGCTTCGTGA
CGATGTCTTTGTTTGCAGTTCTCTAGATGTGTGTTGTAGTGCACTGAATAAAAAAGGTTTTGTAAAAAAAAAA
page-top