Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig2484  (registered. 2003)
Contig Information
Length 656 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_OKCS Seed DPA5 1
Homology (BLAST) Top Hit hypothetical protein OsJ_006732 [Oryza sativa (japonica cultivar-group)]
Score 319
Evalue 6.76365e-28
Total Hit Count 94
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig2484
GTTGGTGAAAAGATGCTTAAACTGGAGGAGCAACAGTTTCTTGGAGAAGCCATCTGTAATTTATCCGACGTATGTTTACTATGGTTAAATCATTGCTGCT
TTTCGTGGCTATTGTTTCTTTCCTTGACTAAATACTTAAGTGCACAAAACATACTTGTGTTGAGGAAAGAGTAACTATTTTGGACCTTCTGCAATGAATA
CGTCAAACTGTGCTGTAAAACTTAAAATAAGTGGTGAAGGGAGGAAAGGACAAAGTAAGAAATCCTGCTTGTATTAACCTGGTGGCCAAGTTTATCTTAT
CATCTGGATTTTCAGCTCTAGAACTGGTTGGTAGTTCCAGTTCCACGACATATTATCCTAGGTTCATCATAAACATACTGTTTTGTGGTTGCAAAGTAGT
GTGGCCAGCACTTGCATATTTTGTTTCTTGAGATCAAAGTTGATTTTGTAGGTTATCACCAAACAGAATAGATTGTTCACCCTAAAGCTTGGTGTTTCTG
AGCACAACTTACCAAATCCTAGTAAATTTGGTGAGTTAACTGTTCAGGCCGAAGAAAGTGCTGGTTCAAAAGCATTAATGGAAATGGTATTCCACTGTTC
AGATCTTGAAATCAAGGATCTTCTTTCAAAAAGTGATCCTTTCTTGCTAATATCCA
page-top