Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5590  (registered. 2012)
Contig Information
Length 820 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 2
Wh_DPA20 Seed DPA20 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115462469|ref|NP_001054834.1|| Os05g0187000 [Oryza sativa (japonica cultivar-group)]
Score 385
Evalue 3.00E-105
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5590
GACTTTTAGATTCATAGACGACAACACCAGAGCCCGTTGACAGTTTAACATAAAGGTCTGCATTAAATCCAGCAAGTACAACAAAATACATCCATTTTTC
CGTTCTAGCACCCACGATGAGAAAAAAGAAGAAATGGCGCAAATTCTTAGCATGACTGCTTGCCTGAACGTAAGCACACAAGATCACTCTTCCATTGCAT
CACTATCAGCGACCTCTGGCTTCAGCTTCAGCTGCGTGATGTTTGTAGACAACACCTCGGTATGCCCCTTGTTGAAGCTGTATCCCTTCGAGCTGACAAA
AGTCCTTGGGTTTGGTAACTCGTGGTTTCTCAAGTACTCTGTGTTCCCCTTAGTTATCACACAAACATCCACATTGCTGCCACTTCCCAAGTCATTGAAG
ATACCAGCACGGATTGCCTCGGCTACAAGTGCAATTCCTTCCTCCCTTGTGAGGCCTTCTCTGTACTTCGACTCAAACACTGACATTGCAGCAAGGGATC
CAGAACCCATCGTGGCAAAAGGAAGAGTATCGGTGGAGCCATGCGGATAAACAGTGTGCAGATGTGGTCCAGTGACATCCACTCCGCCAAGAACAAGAGC
AGCACTGACATGACCTTGGTAGTTAAAAAGATGTGTCTTCAGTAGTGTAAGAGCGGTTACAACTCTTGACTCACGGCTAGTAGCATAACGGTGAAGTTGT
AGCTGGGAGCTGACCATATCTGTCACAGCCTCTGTGTCAGCAGCAGTTCCAGCACCACAGCAATATATGTTTGGTGCCATAAAATGAATTTTCTCGCAGT
TCTTATCAGCAACTATAGGA
page-top