Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5584  (registered. 2012)
Contig Information
Length 903 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_RDr Root of dessiccated seed 3
Wh_SHDr Shoot grown with dessication 6
Wh_VWD Shoot grown with dessication 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242068503|ref|XP_002449528.1|| hypothetical protein SORBIDRAFT_05g017940 [Sorghum bicolor]
Score 253
Evalue 3.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5584
GTCGTCTTATGAAAAGTTCAACTTGATCCATCCAATGTGTAAGCTTCACATCAAATCAGCTAGCTAAATCTCAGAAATGAACACCACAAGCTAGCTTAGC
CGGAGGGATGAGATGAGATGAAATCTCTGGTTACTGCTCCAATCTCGGTACATTTTTCTGGACAGATATATGTAATAATACTACAACACCACAAGCCACC
ATCTAGCTAGCCTGCAACCGAGGGCCTCATCTATGGAGTGCTAGTACAACTTTTTTGGACAAGACATGTAATACTCCCAAGACCACAAGCTAAAATCTCA
AACAAACCAGAAAAACACCACAAGCCAAGAAGCTAGCCGCAGGGATCTCTGGTTACTGCCCCAATCTACTTCAGTGGTCTTTCTTGGGAGCGCCGAAGGA
GAGGAACCTGCTCTTGGCGTTCTCCTTCTCCTTGGGGGACGTCGACGGCGAGGACGACTTGCCGCCGTTCTCCTTCTTGCTGCTGCTGATGCCGCTGCCG
GGGTGGTTGGTGAGGCCGTGCTTCCTGAGCTGCTCCCTGACGAACCTGTCGTAGATGAAGGCCGCTCCCCTGAAGTTGGGCAGCGCCAGCCACGCCAGGA
ACAGCAGCTTCAGCTCGTACCAGATCGGTATCCAGTAGATGAGGGACTCGAGGACCATCTCGACGAGCGTGACGAAGGAGTAGAGGATCCAGTAGGCCAG
CCACTGCTCGTCGTCCAGCTTCGACGGGCTCTCCATCGCCTGCACCGACGCGTACAGCGGGTACAGGAGCATCACGCCAGGCCCTGCGAGGGTGTGGAGG
TGGGTGAGGATGGTCCAGAGCTTGCTCATCTTCTGCAGCTCTTCTTCTTCTCGGCTGGACGAATCAGTGGAAGCGGAGACTGATGGACAGATTCAGAACA
GCG
page-top