Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5582  (registered. 2012)
Contig Information
Length 617 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_SHDr Shoot grown with dessication 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XA Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115474435|ref|NP_001060814.1|| Os08g0109900 [Oryza sativa (japonica cultivar-group)]
Score 303
Evalue 6.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5582
CTCGGGCGGCGCGAGGCGTCACGAATCGAATCGAATCGAGCTCGAGCCGGAGGAGAGCGTCGGAGGCGGCGGGCATGGAGGATCTCAGCGTCGAGGAGCT
CGCCTCCAATCTCTCCACCTACAAGGACCAGCTCCGCGAGGTTAGGAAGTTCATCAAGGAGAAAAAAGATGACGCTGGAATTTCTGAATATGTTGATATG
GAAAAGGAGCTTCAAGAGGTTATTACATTAACCGAAGAGCTTTTGGCAACTGCAAATCCAAGTGAGAGTGCGCAGAATGATGTAGGTCTATCACCGCCAA
ATTATTCTGCTGGAGTGCACTCAGAGGCACTGGATGACCTCTCACAATCCCATGAAAAATTTGCAGTTGGTACCAAAGTGCAAGCTGTGTATAGTGAAGA
TGGGGAGTGGTACAATGCGACAATTGAAGGTCTGACACCAATTGGTTATTTTGTAAGTTATGAAGGCTGGGGAAACAAGGAAGAGGTGGACCCTGCTAAT
GTCAGGGCACTTGACGTGGAAGCTGCTGATGCTTTAGGACTAGCTGAAAAAGAAGCTGAAGCGACAAAAATGGCATTAAAGAGAAAAGTTGAACAAGCAG
CAACATCTGACTATCAG
page-top