Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5573  (registered. 2012)
Contig Information
Length 949 bp
Clones alternative view 79 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 10
Wh_oh Pistil at heading date 4
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 7
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 4
Wh_SHDr Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 5
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 9
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 3
WH_XR Roots, 18 day old plants were grown hydroponically 8
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|118154067|gb|ABK63978.1|| ZIM motif-containing protein [Triticum aestivum]
Score 293
Evalue 2.00E-77
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5573
AGAGAGAGGGAGAGAGGAGCAGTTAGTTGAGAACCTGAGACCCGAGGCGGAGATGGATCTGCTGGAGAGGAGCGCCACTATTAAGGCCGAGGCGGGGGAG
GCCCAGCGGAAGGAAGCGGAGAGGAAGGAGCAGCAGCAGGAGCAGGAGACCCAGCAGCAAGGCCAAGGACTCACCGCCAGACCCCCGCTCGCCAACGGCA
GGTCTGGAATGTTGCCAATGTCGAGCCCTCCAGCAAATCCAGGACAGCTTACCATTTTTTATGGTGGGTCAGTATGTGTGTATGACTCAGTGCCACCAGA
GAAGGCTCAAGCAATCATGCTCATTGCAGCAGCAGCAGCTGCGGCCTCAAAAAGCAATGGCACCGCTGCTGTTAAGCCTCCAGCGATGTCTGCGACCAAT
GCTATCCAAGCCATGCTTACGCGGTCGCTCTCACTTCAGAGCACTTCTGTAGCAAATGGACAACCTCAGGCTGTCGCGGATCCTGGCTCGATTTGCAAGC
TTCAGGCTGATCTTCCCATCGCCAGGAGACACTCCCTTCAGCGCTTCCTGGAGAAGCGCCGTGACAGGGTGGTGAGCAAAGCTCCTTACGGCGCCGGGAA
ACCGTCCGAAGGCATGGGAGCATCTTCTGGGATGGAAGCGGTTGCGGAGGGCAAGGCCCAGTAACCCTGAAAGAAGAAAGACGGCCCTGCCCCTGATGTT
TGGAAGGAAAGGGGCGTGTGTTAGCTGATGTAATGTTACACCGTAGAATCATCGTTCGTGACGATAATAATGATCCGACCAGAACTCCTCTAGTATCATT
GTTCTGTTGTCATTGTGTAGTTTACTCTGTATCTGAACTTTGTTTTACTCAGCGGAACCGTACTGCTATGATGAATGTGTCGATGTAAATCGTGGCTGTC
GTGCCTGTCTGACTGATACATTGTTCATGTAGTCGATGAATGATAGCAC
page-top