Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5562  (registered. 2012)
Contig Information
Length 1573 bp
Clones alternative view 53 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 3
Wh_r Root 4
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 3
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VWD Shoot grown with dessication 6
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|270233740|emb|CBI22349.1|| unnamed protein product [Vitis vinifera]
Score 473
Evalue 4.00E-131
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5562
TAGACGACTGCCTAAAGCCTAGATGGATTTTTTTTTCATTTGTACAGCCTAGCTAACCCCTCAAAGAAAGTTCATGTTTCAAACCAAGGAGAAAACAAAA
GCCGTTCACAGTGCAAATTAAGCAGGGCAAATGTCTTTAACATAACAACATGGTGTAACACTGCCATTATCACAACCCCAGGTAACACAGTTTATGTTAT
TTATAAACTTCACAGTAACAGCACACTAGATTTGCAGGTTGATCATAGGGAAAACATGTTCAGGCTGTCAATAATCATCATGGGTACAATAATGCACTAC
TTAAATAGTAGCTCGCTGGAGTTCTGCCCACACATTGAGCTCTGAAGACACTGGGACTGGAATGCAACCAAAGCTATCATCGCAGGCAAAGATAGGTGAC
AAACCTGCAATGGCCGGGGTGATGAGGCTAGTTGTAGTAGAGCTCGAGGCCCATGCCGTCGTGGATCTCGTAGTCGCCAAGGGTGATGTGGTCCTTGTAG
ATGGTGTACCACTTCTGGATGCGGATCTTCTCGGCCCTGGTCCCGGTCTGCGCCGCCACGAGCTTCTTGAGGTCGCCGATGGTGTCGTCCTCGTTGCACT
TGACGCGCACCTTCTTCCCCAGGCGGTCGTTGAGCACCACCTCGATCATCTTCCCTCCCGCTCGCGTCGATTGATCGATCGACCGACCAAACCCTAGCCC
CGGCGAGAGCTGCAGCGCCCTTGTGCTTTTCAATTGAGAATCGAATTCGGCACGAGGCAGAACGGAACGAACGAAAAATCCCCAACCAATCTCGTCGCCG
ATCAACCCTAGGCTCGTCGAATCCTCCTCCCCCACCGCATAAGATGCAGATCTTTGTGAAGACATTGACTGGCAAGACCATCACCCTTGAGGTGGAGTCG
TCTGACACAATCGATAATGTCAAGGCCAAGATCCAGGACAAGGAGGGCATCCCTCCGGACCAGCAGCGTCTCATCTTTGCTGGCAAGCAGCTTGAGGATG
GCAGGACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTTCACCTTGTCCTCCGCCTTAGGGGAGGCATGCAGATCTTCGTCAAGACGTTGACTGG
CAAGACCATCACCCTTGAGGTGGAGTCGTCTGGCACCATTGACAACGTCAAGGCCAAGATCCAGGACAAGGAGGGCATCCCTCCGGACCAGCAGCGCCTC
ATCTTTGCTGGCAAGCAGCTCGAGGATGGCAGGACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTTCACCTTGTCCTCCGCCTTAGAGGAGGCA
TGCAGATCTTCGTGAAGACCCTCACTGGCAAGACCATAACACTTGAGGTGGAATCCTCCGACACCATCGACAACGTCAAGGCCAAGATCCAGGACAAGGA
GGGCATTCCCCCGGACCAGCAGCGCCTCATCTTTGCTGGCAAGCAGCTGGAGGATGGCCGCACCCTTGCTGACTACAACATCCAGAAGGAGTCCACCCTT
CACCTTGTCCTGCGTCTCCGTGGTGGTATGCAGATCTTTGTGAAGACCCTTACCGGCAAGACCATCACTCTGG
page-top