Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5556  (registered. 2012)
Contig Information
Length 789 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHDr Shoot grown with dessication 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|194690134|gb|ACF79151.1|| unknown [Zea mays]
Score 466
Evalue 9.00E-130
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5556
TTGTTCCGGTTGCGCTCGCAGAGAGATCGGGTCGGGGAGGAGGAGGATGACGGGCGGGCGCGCGGTGCTTCTGCTGGTGGTCTCGGCGCTGTTCGCGCAG
ATCTACGCGTCGGATCCGCTGTTTCACGAGTCCTTCGACGAGGGCTTCCAGGGGAGCTGGATCGTCTCCGGCAAGGAAGAGTACTCAGGTGTATGGAAGC
ACGAGAAGAGTGATGGCCATGAAGACTATGGTCTCCTTGTTAGCGAGCCAGCCAGGAAATATGCCATAGTCAAAGAGCTTGATAGCCCTGTTACTTTGAA
GGATGGAACAGTTGTCCTGCAGTTCGAAGTGAGGCTTCAGAATGGCCTTGAGTGTGGAGGTGCTTATCTTAAGTACATTCGCCCTCAGGAGGCTGGATGG
GATGCCAAGGAATTTGACAATGACACTCCTTACACAATTATGTTTGGTCCTGACAAGTGTGGTTCAACGAACAAGGTTCACTTCATCCTGAAGCACAAGA
ACCCCAAGACTGGCAAATATGTTGAACATCACCTTAAGTCCCCACCCTCTGTCCCATATGACAAGCTCTCTCATGTCTATACGGCTATCTTGAAGCCAGA
TAACGAGGTCAGAATTCTGGTTGACGGGGAGGAGAAGAGCAAAGCAAACTTCCTGTCCGCTGATGATTTTGAGCCAGCACTTATTCCATCAAAGACTATT
CCTGACCCTGACGACAAGAAGCCAGAGGACTGGGACGAGAGAGCTAAAATCCCTGACCCAGCTGCAGTGAAGCCCGATGACTGGGATGA
page-top