Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5555  (registered. 2012)
Contig Information
Length 853 bp
Clones alternative view 42 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_f Spike at flowering date 1
Wh_yd Spikelet at late flowering 3
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 4
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218193998|gb|EEC76425.1|| hypothetical protein OsI_14101 [Oryza sativa Indica Group]
Score 382
Evalue 2.00E-104
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5555
CCAAATTTAAGCTAAGAATTCAGAATGAAATTTTTTTTTTTTTTTAGTCCAAATAATAAGCATTAAGCTGAAATCAACAATGAGCCAAAACATGCATCAT
TGCATTGTTCACGACACACACAAGTCTCGTGATGCTACAGACCAAAAAGTACAACAAAACTTCCAGCCCAGGTGATATGATTGGCACCCAGGACTGAATA
AAATGGTGTATAGTGTATTTCTCACTATATAAAAGCGACTAACTTAGTCGACCTCCTCGATCTTGGGGCCAGCACCGCCGCTCGCAGCCGGCGCGTCCTC
GTCCATGCCTCCGGGCATGTCAGCACCGGCGCCCTGGTACATCTTGGCGATGATGGGGTTGCAGAGGCCCTCCAGCTCCTTCATCTTGTCCTCAAACTCG
TCAACCTCACCGAGCTGGTTGGCGTCAAGCCACTGGATCGCGGCGTCAACGGCGTCCTCGATCTTCTTCTTGTCATCAGCAGGCAGCTTGGAGGCGATCT
TCTCGTCCTGGATGGTGTTCCTCATGTTGTAGGCGTAGTTCTCCAGGGAGTTCTTGGCGTCAACCTTCTTCTTGTGCTCCTCGTCCTCAGACTTGTACTT
CTCTGCGTCCTGGACCATCTTCTCAATGTCGTCCTTGCTCAGCCTGCCCTTGTCGTTGGTGATGGTGATCTTGTTCTTCTGGCCAGTGGTCTTGTCCTCA
GCAGAGACATTCAGGATACCGTTGGCATCAATGTCGAAGCAGACAGTGATCTGGGGAACACCCCTGGGCGCAGGCGGGATGCCAGAGAGCTCAAACTTGC
CGAGCAGGTTGTTGTCCCTGGTCCTTGTCCTCTCACCCTCAAACACCTGGATG
page-top