Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5549  (registered. 2012)
Contig Information
Length 1063 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_DPA20 Seed DPA20 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115436430|ref|NP_001042973.1|| Os01g0348600 [Oryza sativa (japonica cultivar-group)]
Score 602
Evalue 2.00E-170
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5549
GAGCGAGACCTGCAAGAAACAAACACCGGGCGGCAGGCGGGATCGATCTTGGGAACCAGCGGAGGAGATGGCGGCCAAGGGGGCGACCGAGATGGAGGTG
GGCGGCGACGGCGTCGCCGTCATCACCATCTGCAACCCGCCGGTCAACTCCCTCTCCATCGATGTACTCCTAAGCTTAAAGGAAAGCTATGAAGAAGCTC
TGCAGAGGAAGGATGTCAAAGCTATTGTTGTTACAGGGAAAGGAGGAAAATTTTCTGGAGGATTCGATATTAGTTCCTTTGGGGATCTTCACAGTGGAAA
AATTGAGCAGCCAAAGGTTGGTTACATATCAATAGACATTCTCACTGAACTTCTGGAAGGTGCAACAAAGCCATCGGTGGCTGCAATTGATGGTCTTTGT
CTTGGCGGAGGATTAGAAGTTTCCATGGCATGCCATGCACGTATTTCAACTCCCACTGCTCAATTAGGTCTTCCAGAACTTCAACTTGGGATCATTCCAG
GATTTGGAGGAACACAGCGACTCCCACGTCTTGTTGGACTGACAAAGTCACTGGAAATGATGTTGCTATCCAAGCCAATTAAGGGCGAAGAGGCACACCA
ACTGGGTCTTGTTGATTCCTTAGTTTCTCCTAATGATTTGGTGAATACTGCTCGTCGTTGGGCTTTGGATATCTGTGAGCTCAGAAAGCCATGGATCAAA
AGCCTTTACAAGACCGACAAACTGGAACCCCTTGGCGAGGCTAGGGAGATTCTCAAGTTTGCAAGGGCTCAAGCTCGAAAGCAGGCTGCAAATCTTGAAC
ACCCACTTATTTGTATTGATGTCATTGAAGAAGGTATAGTTTCAGGACCTCGAGCTGGGCTCTGGAAGGAAGCAAACGCATTCCAGGGCCTTCTTTTCTC
AGATACATGTAAAAGCTTACTTCATGTATTCTTCTCTCAGCGTGCAACATCAAAGGTTCCTGGTGCTACAGACTTGGGTTTGATGCCTAGGAAAATAACG
AAAGTCGCCATTCTAGGTGGTGGGCTTATGGGTTCTGGAATTGCTACCGCAATGATACTAAGT
page-top