Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig2031  (registered. 2003)
Contig Information
Length 639 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_SHC Shoot grown with cold treatment 1
Homology (BLAST) Top Hit hypothetical protein OsI_19876 [Oryza sativa Indica Group]
Score 859
Evalue 1.56827e-90
Total Hit Count 115
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig2031
CTTGCACAGGACACACATAACCAAGCAGGTATTGCATACAATGGTGGCTTGTTGCCTTTACTAAAGCTTCTTGACTCAAAAAATGGTTCTCTGCAACATA
ATGCTGCGTTTGCTCTTTATGGAGTTGCGGACAATGAGGATTATGTCTCTGACTTCGTTAAAGTAGGAGGTGTCCAAAAGTTGCAGGATGGAGAATTTAT
CGTCCAGGCTACAAAGGACTGTGTAGCTAAGACATTGAAGAGGCTAGAGGAGAAGATAAATGGACGAGTGTTAAAACACTTGGTTTATCTCATGAGAGTA
GGAGAAAAGTCTGTGCAGAGGCGTGTTGCTCTGGCTCTCGCACACCTCTGTGCCCCTGAAGATCAGCGAACAATTTTTATTGATAATAATGGTCTCGACT
TGCTTCTTGATCTTCTGGTTTCGGTCAGCTCGAAACATCAACAGGATGGTTCGGTAGCACTATACAAATTANCCAACAAAGCTGCAGCACTCTCTCCGAT
GGATGCTGCACCTCCATCTCCAACGCCACAGGTTTATCTTGGAGAGCAATATGTGAACANTTCGACACTTTCANATGTCACCTTCTTGGTGGAAGGAAAA
CGCTTTTATGCNCACANAATTGCTTTGCTTGCTTCTTCA
page-top