Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5544  (registered. 2012)
Contig Information
Length 1231 bp
Clones alternative view 194 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 6
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 11
Wh_h Spike at heading date 7
Wh_oh Pistil at heading date 3
Wh_r Root 2
Wh_yd Spikelet at late flowering 12
Wh_SH - 2
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 9
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 15
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 11
Wh_VABA Shoot with ABA treatment 11
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 3
Wh_VWD Shoot grown with dessication 7
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 6
WH_XN Leaves, plant was grown at constant 23 8
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XA Root 7
WH_XB Root 8
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 8
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222625756|gb|EEE59888.1|| hypothetical protein OsJ_12490 [Oryza sativa Japonica Group]
Score 368
Evalue 9.00E-100
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5544
TGTGCTTCTTGCTACAAACTTTTCGCCGACTGCCAGAAAAAGAACTACAACTTTCACTTACCTTGCATGACATTTTTTTTAGAAAAGGAGGAAGACCTGC
ATCTGGTCGATGCAACCTTGCATGACATATCAAAGCTAATGTAGCGACACATTTAACCGAATGACAGTCGACAACAAGGGGTAAAAAACATTAGCACGGT
GAAACTCAAGTATCCTTTCCGGGTCACTCCCAAGCTTTATTCTGCGTCTATCACCATCAGCTGAGATGGATGGTCTATACGCTCCAGAAACAAGCACGCG
GCGGCGCGCGGCCACGGAAATATGCACTAAATAAGCAGGAAAACATCACACACGCAAATTCAAGTTCAACAGCCATTGTCCGCGAAGAAACACGGCCTAT
TTCGTCATCATCACCCTGGTCGTTATTGTAGAGTTCACTCAAAGGGACGCCCTGCAAAACGGCTGGGTCCTAGTACCCACCCTGGATGTAGGCGTTGAGC
CGGTTCAGCTCCTCCTTGTGCTCGCTGACCACCGCGCGAACCACGTCGCCGATGGAGACCATCCCCATCATCTCCGTGCCGCTGATCACCGGGATGTGCC
TGATACGCTTTTCTGTCATCAGCTGCATTGCTTTCAGGACTCTGGTTTCAGGTTTCACCGTGATCAGCTTGTTCTCTTCGGTCATGATATCTCCAACTTT
GGTTGACTTGGAGGATCGACCCTGCACTATAATTTTCCGGAGATAATCTCTCTCTGTGACGATGCCCGCAATTGATTTATCTTCCCCAGGTTTAACAACC
ACCAAAGCTCCCACATTGTGCTGTGTCATCGATTTGACAGCATCATAGACACTATCATCAGTGGTGCACCAGAGCCATGATCCATCGGCACTCTTCCCTT
TAGACTTCAAAATGTCTGCAACAGTGCTGCTCTCAAATCCACTCTCCTCTATTTGAGCAGATGATACTGACATGAAGCGTGGGAACACAGCGGGCAGCAT
AGCAGGCTTCACAACACTGATGTGTTGCAGGACAGCAGATTTGAGCACACTGCCATGTGATCCGATAGCTTGAATTGCTCGCTGCATTTTGTTCTGCGTG
GCCACGGGACTGAGCTTCGGTTGTGGGAGGAGCAGCGAGTTGCGGGGAGGAAGAAGATGGGGGAGGGACGCTTGTGATGCTGGGAGGCAGTGGTGGGGGG
TGACGAGCGCTAATTAAAGCCTCGTGCCGAA
page-top