Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5538  (registered. 2012)
Contig Information
Length 611 bp
Clones alternative view 47 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 3
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 5
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|23954355|emb|CAD54079.1|| metallothioneine type2 [Hordeum vulgare subsp. vulgare]
Score 180
Evalue 1.00E-43
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5538
GTATAAAGATACACCGATTCCAAGCGGTGCACACGTTGCTTCAAGAGAGCATTCGGCTGGTCTAGTAACAACCCAGGCACCTCGCAAGTTGATAGTACAA
TTTTTTTTTTAGGTTAAACCACGGGAGATTTTATTTAGGGGTCGGTTTACATGCATGGCAGTGCACCTGCTCTGCTCATGCTGGCAGGTGCTTACATACA
TACAAAGACCCTCGATCAGGTGGCGTTACATGGTAAGTAGATTGTAGATAGATCATAGATATGATGCGCGCGGTGCATGCATGACCGATGATAGATCTAG
CAGCTGCAGCAGGAGCAGCCGCAGCTGGTGCCGCACTTGCACTGGGTGCAGCCGCAGCCGCCGTTCTCCGCCGCCATCTCCATCCCGCCCGAGCTCGCCT
TGTGGGTGGCGGTGGCGGAGACGAGGAGGGTGGCGCCGGCGGCCTCAACCTCCGGGTACATGTTGCAGCCGCCGCAGCCGTTGCCGCACTTGCAGGCGCT
GCCGCAGCCGCAGTTTCCTCCGCAGCAAGACATCCTCGAGGTTGCTTGGGATTGGATGGAGGCTTTGATTGGTGTTGGCTAGGAGCTTCCTGTGTGCTTC
TTGCCTCGTGC
page-top