Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5534  (registered. 2012)
Contig Information
Length 877 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108925894|gb|ABG23315.1|| vacuolar proton-ATPase D subunit [Triticum aestivum]
Score 472
Evalue 3.00E-131
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig5534
CAGCTGAGCCGGGCACGACCTTTGGCTTGTGAAGGCGAATTCTTTTGTGGCTGATAGATAAAAATCTCCACCACATTCGCAAGCGCGAACTCCCTCCCGG
ATCTACTACTAGCCGGCTCCCCTCCCGATCCCTCTCGCCGCGGCCGAGATCCTTCCTTCCTCCGGCGAGAGCCAGGATGTACTCGTGGGAGATGCTGTCG
TTCAACATCCACGACGGGTTCCTGGAGGCGATCGTACGGGGGAACCGCTCGGGCCTCCTCACCCAAGCCGATTACAACAACCTCTGCCAGTGCGAGACCC
TCGACGACATCAAGATGCACCTCTCCGCCACCGAGTACGGTCCATACCTCCAGAACGAACCTTCCCCCTTGCACACAACAACAATTGTGGAGAAGTGCAC
TCTTAAGCTGGTTGATGAATACAAACACATGTTGTGCCAGGCGAATGAACCTCTATCTACATTCCTACAGTACATAACATATGGACACATGATCGATAAT
GTTGTCCTTATTGTTACTGGGACATTGCATGAAAGAGATGTTAACGAACTGTTGGAGAAATGCCATCCATTGGGCATGTTTGACAGCATTGCATCACTTG
CGGTTGCTCAAAATATGCGTGAGCTTTACAGGCTGGTTCTAGTTGATACACCCTTAGCACCGTACTTCTCAGAGTGCATTACATCTGAGGATCTGGATGA
CATGAATATTGAGATCATGAGGAACACACTCTACAAAGCGTATCTTGAGGATTTTTACAAATTTTGTGCGAAACTAGGTGGTGCGACGGCTGAGNTTATG
TGTAATCTCCTTTCATTTGAAGCTGACAGANGAGCTGTAAACATTACCATAAACAGTATTGGTACTGAGCTGACTAG
page-top